Transcript: Human XR_001744514.1

PREDICTED: Homo sapiens aminoadipate-semialdehyde synthase (AASS), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AASS (10157)
Length:
5761
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744514.1
NBCI Gene record:
AASS (10157)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218483 ACCAATATTGGAGCGAATTAA pLKO_005 2750 3UTR 100% 15.000 21.000 N AASS n/a
2 TRCN0000045677 CGGTACATTACCTGATAAATA pLKO.1 1480 3UTR 100% 15.000 12.000 N AASS n/a
3 TRCN0000045676 GCCACGATTGAATCATATATT pLKO.1 1994 3UTR 100% 15.000 12.000 N AASS n/a
4 TRCN0000229931 TACTACACAGAGTACAATTAA pLKO_005 2789 3UTR 100% 15.000 12.000 N AASS n/a
5 TRCN0000229932 CCACTAACAGAGAACTTTAAT pLKO_005 3000 3UTR 100% 15.000 10.500 N AASS n/a
6 TRCN0000218051 TATCAAGAGATGGCAATATAG pLKO_005 1620 3UTR 100% 13.200 9.240 N AASS n/a
7 TRCN0000045673 CCACACAAACTCGTGGCAATA pLKO.1 1160 3UTR 100% 10.800 7.560 N AASS n/a
8 TRCN0000045675 CGCCTTATTGATTATGAGAAA pLKO.1 518 3UTR 100% 4.950 3.465 N AASS n/a
9 TRCN0000045674 GCTACATATCTGAGCCTGTAT pLKO.1 1590 3UTR 100% 4.950 3.465 N AASS n/a
10 TRCN0000229930 CAACGGTACATTACCTGATAA pLKO_005 1477 3UTR 100% 13.200 7.920 N AASS n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3238 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13766 pDONR223 100% 3.8% None (many diffs) n/a
2 ccsbBroad304_13766 pLX_304 0% 3.8% V5 (many diffs) n/a
3 TRCN0000474083 TCTCGACACAAACAGACTTCAACG pLX_317 100% 3.8% V5 (many diffs) n/a
Download CSV