Transcript: Human XR_001744711.1

PREDICTED: Homo sapiens CASTOR family member 3 (CASTOR3), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASTOR3 (352954)
Length:
4129
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744711.1
NBCI Gene record:
CASTOR3 (352954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137335 GCCGTTCTTCATTTGACTCAT pLKO.1 1199 3UTR 100% 4.950 6.930 N CASTOR3 n/a
2 TRCN0000138307 CCAGTCAGAAACTACCGACTA pLKO.1 3896 3UTR 100% 4.050 5.670 N CASTOR3 n/a
3 TRCN0000136621 GCAGGATCAATGATGGGATAA pLKO.1 1638 3UTR 100% 10.800 8.640 N CASTOR3 n/a
4 TRCN0000138549 CGTTGTCATCAGAGTTCACCA pLKO.1 737 3UTR 100% 2.640 1.584 N CASTOR3 n/a
5 TRCN0000137168 GTTGTCATCAGAGTTCACCAT pLKO.1 738 3UTR 100% 2.640 1.584 N CASTOR3 n/a
6 TRCN0000352396 CACTGGCTGACCAGAACATAT pLKO_005 641 3UTR 100% 13.200 6.600 Y CASTOR2 n/a
7 TRCN0000337256 ACTGGCTGACCAGAACATATC pLKO_005 642 3UTR 100% 10.800 5.400 Y CASTOR2 n/a
8 TRCN0000337255 CAGAGGATTACACTATCATTG pLKO_005 467 3UTR 100% 10.800 5.400 Y CASTOR2 n/a
9 TRCN0000337254 TGTTCATGCTGTCCACGTATC pLKO_005 665 3UTR 100% 6.000 3.000 Y CASTOR2 n/a
10 TRCN0000138621 CAAGACCAGGTGCAAGTTCTT pLKO.1 429 3UTR 100% 4.950 2.475 Y CASTOR3 n/a
11 TRCN0000137329 GATCAAACTTGCCTTCCTGTT pLKO.1 405 3UTR 100% 4.050 2.025 Y CASTOR3 n/a
12 TRCN0000138745 CAGGTGCAAGTTCTTCAGTCT pLKO.1 435 3UTR 100% 2.640 1.320 Y CASTOR3 n/a
13 TRCN0000136784 CCAGAACATATCCGTGTTCAT pLKO.1 651 3UTR 100% 0.495 0.248 Y CASTOR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13623 pDONR223 100% 11.7% None (many diffs) n/a
2 ccsbBroad304_13623 pLX_304 0% 11.7% V5 (many diffs) n/a
3 TRCN0000477107 CCCCAGACCGATGGGTCGTTCCAT pLX_317 67.1% 11.7% V5 (many diffs) n/a
Download CSV