Transcript: Human XR_001746345.1

PREDICTED: Homo sapiens nipsnap homolog 3B (NIPSNAP3B), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NIPSNAP3B (55335)
Length:
2067
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746345.1
NBCI Gene record:
NIPSNAP3B (55335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168655 GAAAGCCTTAGCCAACTGTAA pLKO.1 800 3UTR 100% 4.950 6.930 N NIPSNAP3B n/a
2 TRCN0000167791 GACGGAAATTACTTACCTGAT pLKO.1 875 3UTR 100% 4.050 5.670 N NIPSNAP3B n/a
3 TRCN0000172969 GCCAACTGTAAGGAATGGCAA pLKO.1 810 3UTR 100% 2.640 3.696 N NIPSNAP3B n/a
4 TRCN0000168499 GCTTCTGATTCCTGCATCATT pLKO.1 1291 3UTR 100% 5.625 3.938 N NIPSNAP3B n/a
5 TRCN0000168359 GCTCTAAGATGTGTCTGCTAA pLKO.1 1361 3UTR 100% 4.950 3.465 N NIPSNAP3B n/a
6 TRCN0000166932 GAACGTTCTATGAATTTCGTA pLKO.1 601 3UTR 100% 3.000 2.100 N NIPSNAP3B n/a
7 TRCN0000144213 CAGCAGAATATGCTTCTGATT pLKO.1 1280 3UTR 100% 0.495 0.248 Y NIPSNAP3A n/a
8 TRCN0000144608 GAAAGTGTCAACTACCTAGTA pLKO.1 1256 3UTR 100% 4.950 2.475 Y NIPSNAP3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03584 pDONR223 100% 35.8% None 1_500del;1079_1161del;1325_2067del n/a
2 ccsbBroad304_03584 pLX_304 0% 35.8% V5 1_500del;1079_1161del;1325_2067del n/a
3 TRCN0000481287 CCCAGGGAGACTGACGTTACTGCA pLX_317 58.6% 35.8% V5 1_500del;1079_1161del;1325_2067del n/a
4 ccsbBroadEn_02888 pDONR223 100% 32.6% None (many diffs) n/a
5 ccsbBroad304_02888 pLX_304 0% 32.6% V5 (many diffs) n/a
6 TRCN0000474361 CAGACAACCGACCCGATGCCGGAT pLX_317 70.3% 32.6% V5 (many diffs) n/a
Download CSV