Transcript: Human XR_001746412.2

PREDICTED: Homo sapiens far upstream element binding protein 3 (FUBP3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FUBP3 (8939)
Length:
3156
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746412.2
NBCI Gene record:
FUBP3 (8939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220168 CGGCGATTTCAACTCTCGAAT pLKO.1 778 3UTR 100% 4.950 6.930 N FUBP3 n/a
2 TRCN0000220171 GCATATCATCAGCGAGCTGAT pLKO.1 988 3UTR 100% 0.405 0.567 N FUBP3 n/a
3 TRCN0000220169 CCTGGCTTTCATAATGACATA pLKO.1 500 3UTR 100% 4.950 3.465 N FUBP3 n/a
4 TRCN0000220170 CCTCTTCGTATCACTGGAGAT pLKO.1 677 3UTR 100% 4.050 2.835 N FUBP3 n/a
5 TRCN0000220172 GACGGTAATAACGGAAGAATT pLKO.1 271 3UTR 100% 0.000 0.000 N FUBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11320 pDONR223 100% 23.8% None (many diffs) n/a
2 ccsbBroad304_11320 pLX_304 0% 23.8% V5 (many diffs) n/a
3 TRCN0000473445 ATCTCCGTTGTCTGGATAATCCTT pLX_317 50% 23.8% V5 (many diffs) n/a
Download CSV