Transcript: Human XR_001747206.1

PREDICTED: Homo sapiens MINDY lysine 48 deubiquitinase 3 (MINDY3), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MINDY3 (80013)
Length:
2203
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747206.1
NBCI Gene record:
MINDY3 (80013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310273 TGAATGATTCCGGCTTGTAAT pLKO_005 1766 3UTR 100% 13.200 18.480 N MINDY3 n/a
2 TRCN0000264565 GAGCGATTTCATGCATTAATT pLKO_005 650 3UTR 100% 15.000 10.500 N Mindy3 n/a
3 TRCN0000056108 CCCTTGATAGATCCTGTATAT pLKO.1 830 3UTR 100% 13.200 9.240 N MINDY3 n/a
4 TRCN0000289714 CCCTTGATAGATCCTGTATAT pLKO_005 830 3UTR 100% 13.200 9.240 N MINDY3 n/a
5 TRCN0000056112 CTGAGGAAACTGCTAGTATTT pLKO.1 558 3UTR 100% 13.200 9.240 N MINDY3 n/a
6 TRCN0000307133 CTGAGGAAACTGCTAGTATTT pLKO_005 558 3UTR 100% 13.200 9.240 N MINDY3 n/a
7 TRCN0000056111 CAATGGATTGAAGCAGTCAAA pLKO.1 1197 3UTR 100% 4.950 3.465 N MINDY3 n/a
8 TRCN0000056110 GTTCAGAAGTTTACCAGAATT pLKO.1 682 3UTR 100% 0.000 0.000 N MINDY3 n/a
9 TRCN0000289715 GTTCAGAAGTTTACCAGAATT pLKO_005 682 3UTR 100% 0.000 0.000 N MINDY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04165 pDONR223 100% 49.1% None (many diffs) n/a
2 ccsbBroad304_04165 pLX_304 0% 49.1% V5 (many diffs) n/a
3 ccsbBroadEn_12660 pDONR223 100% 18.4% None 1_211del;497A>G;620_2203del n/a
4 ccsbBroad304_12660 pLX_304 0% 18.4% V5 1_211del;497A>G;620_2203del n/a
5 TRCN0000479216 CAGTGCTACCGAGAATATCCGGTA pLX_317 100% 18.4% V5 1_211del;497A>G;620_2203del n/a
Download CSV