Transcript: Human XR_001747256.1

PREDICTED: Homo sapiens beta-transducin repeat containing E3 ubiquitin protein ligase (BTRC), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTRC (8945)
Length:
6359
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747256.1
NBCI Gene record:
BTRC (8945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314900 ACTTGCCCAGGACCCATTAAA pLKO_005 2191 3UTR 100% 15.000 21.000 N BTRC n/a
2 TRCN0000006543 GCGTTGTATTCGATTTGATAA pLKO.1 1878 3UTR 100% 13.200 18.480 N BTRC n/a
3 TRCN0000314899 GCGTTGTATTCGATTTGATAA pLKO_005 1878 3UTR 100% 13.200 18.480 N BTRC n/a
4 TRCN0000314901 TTACCAACATGGGCACATAAA pLKO_005 934 3UTR 100% 13.200 10.560 N BTRC n/a
5 TRCN0000006541 CCATTAAAGTTGCGGTATTTA pLKO.1 2204 3UTR 100% 15.000 10.500 N BTRC n/a
6 TRCN0000314972 AGATGTGGAAGACATAGTTTA pLKO_005 1210 3UTR 100% 13.200 9.240 N BTRC n/a
7 TRCN0000006542 GCACATAAACTCGTATCTTAA pLKO.1 946 3UTR 100% 13.200 9.240 N BTRC n/a
8 TRCN0000006544 GCGTTTCAATAATGGCATGAT pLKO.1 1518 3UTR 100% 4.950 3.465 N BTRC n/a
9 TRCN0000006545 GCTGAACTTGTGTGCAAGGAA pLKO.1 1070 3UTR 100% 3.000 2.100 N BTRC n/a
10 TRCN0000314969 GCTGAACTTGTGTGCAAGGAA pLKO_005 1070 3UTR 100% 3.000 2.100 N BTRC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02053 pDONR223 100% 26.6% None (many diffs) n/a
2 ccsbBroad304_02053 pLX_304 34.3% 26.6% V5 (many diffs) n/a
3 TRCN0000469234 CAGCAAGAGATGAGACCATGAATA pLX_317 16% 26.6% V5 (many diffs) n/a
Download CSV