Transcript: Human XR_001747752.1

PREDICTED: Homo sapiens HPS5 biogenesis of lysosomal organelles complex 2 subunit 2 (HPS5), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPS5 (11234)
Length:
4648
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747752.1
NBCI Gene record:
HPS5 (11234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084039 GCACCTACAATGATCTAATTT pLKO.1 1248 3UTR 100% 15.000 21.000 N HPS5 n/a
2 TRCN0000229872 GATCTACCAACAAGGTTAAAG pLKO_005 2510 3UTR 100% 13.200 18.480 N HPS5 n/a
3 TRCN0000229873 CATGAAGACAGATGGTATTAT pLKO_005 3834 3UTR 100% 15.000 10.500 N HPS5 n/a
4 TRCN0000229870 GTGTTGTACAGTTAGATTATT pLKO_005 558 3UTR 100% 15.000 10.500 N HPS5 n/a
5 TRCN0000218549 CCAGGATGTGCTATTAGTTAA pLKO_005 2035 3UTR 100% 13.200 9.240 N HPS5 n/a
6 TRCN0000229871 TGGCACCTACAATGATCTAAT pLKO_005 1246 3UTR 100% 13.200 9.240 N HPS5 n/a
7 TRCN0000084040 CCTGGCTGAATTGACAACATT pLKO.1 2233 3UTR 100% 5.625 3.938 N HPS5 n/a
8 TRCN0000084041 GCTGGGATACAGCTATTCTTA pLKO.1 414 3UTR 100% 5.625 3.938 N HPS5 n/a
9 TRCN0000084038 CCCACAAGAATCATGCACTTT pLKO.1 4380 3UTR 100% 4.950 3.465 N HPS5 n/a
10 TRCN0000084042 CCATTTCATCACATGAAAGTT pLKO.1 1335 3UTR 100% 0.563 0.394 N HPS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07781 pDONR223 100% 61.7% None (many diffs) n/a
2 ccsbBroad304_07781 pLX_304 0% 61.7% V5 (many diffs) n/a
3 TRCN0000468429 TCTCCGTCTACCTCTTCTCTCCCC pLX_317 13.6% 61.7% V5 (many diffs) n/a
Download CSV