Transcript: Human XR_001748588.1

PREDICTED: Homo sapiens glycosyltransferase 1 domain containing 1 (GLT1D1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLT1D1 (144423)
Length:
1322
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748588.1
NBCI Gene record:
GLT1D1 (144423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244006 GGATTTAGAAGTACCGGTATT pLKO_005 1184 3UTR 100% 10.800 15.120 N GLT1D1 n/a
2 TRCN0000244004 GTCGCTTTCACAGAGTCAATG pLKO_005 590 3UTR 100% 10.800 8.640 N GLT1D1 n/a
3 TRCN0000150003 CACAGAGTCAATGAAGGAAAT pLKO.1 598 3UTR 100% 10.800 7.560 N GLT1D1 n/a
4 TRCN0000257200 TGGTTAGTGATCCTGCATTAG pLKO_005 1303 3UTR 100% 10.800 15.120 N GLT1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13224 pDONR223 100% 34.4% None 1_259del;580_679del;816_1322del n/a
2 ccsbBroad304_13224 pLX_304 0% 34.4% V5 1_259del;580_679del;816_1322del n/a
3 TRCN0000468079 CTAACGTCTCAGGCCCGACTTGTC pLX_317 67% 34.4% V5 1_259del;580_679del;816_1322del n/a
Download CSV