Transcript: Human XR_001748674.2

PREDICTED: Homo sapiens TANK binding kinase 1 (TBK1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBK1 (29110)
Length:
3145
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748674.2
NBCI Gene record:
TBK1 (29110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003185 GCGGCAGAGTTAGGTGAAATT pLKO.1 1588 3UTR 100% 13.200 18.480 N TBK1 n/a
2 TRCN0000314840 GCGGCAGAGTTAGGTGAAATT pLKO_005 1588 3UTR 100% 13.200 18.480 N TBK1 n/a
3 TRCN0000003186 CGGGAACCTCTGAATACCATA pLKO.1 1264 3UTR 100% 4.950 6.930 N TBK1 n/a
4 TRCN0000314839 CGGGAACCTCTGAATACCATA pLKO_005 1264 3UTR 100% 4.950 6.930 N TBK1 n/a
5 TRCN0000380974 GGATATCGACAGCAGATTATC pLKO_005 1674 3UTR 100% 13.200 10.560 N TBK1 n/a
6 TRCN0000314842 ATTTGATGTGGTCGTGTAAAT pLKO_005 2517 3UTR 100% 13.200 9.240 N TBK1 n/a
7 TRCN0000314841 TGGTATAGTGCACCGTGATAT pLKO_005 501 3UTR 100% 13.200 9.240 N TBK1 n/a
8 TRCN0000196717 GCTAGAGAATTAGAAGATGAT pLKO.1 595 3UTR 100% 4.950 3.465 N TBK1 n/a
9 TRCN0000003183 GTATTTGATGTGGTCGTGTAA pLKO.1 2515 3UTR 100% 4.950 3.465 N TBK1 n/a
10 TRCN0000003184 CCAGGAAATATCATGCGTGTT pLKO.1 526 3UTR 100% 4.050 2.835 N TBK1 n/a
11 TRCN0000199632 GCCTGTTTCTTGCAGTCTTTC pLKO.1 903 3UTR 100% 10.800 6.480 N TBK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488336 GCGGACAACATAGATTCGGCTTGC pLX_317 15.9% 69.5% V5 (many diffs) n/a
2 TRCN0000489401 ATTTTTCATCCTTTACTTGGCCGT pLX_317 17% 69.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_08116 pDONR223 100% 69.4% None (many diffs) n/a
4 ccsbBroad304_08116 pLX_304 31% 69.4% V5 (many diffs) n/a
5 TRCN0000475435 AGGCTGTCTGTAGTGTTCATCTCG pLX_317 25.6% 69.4% V5 (many diffs) n/a
6 ccsbBroadEn_15050 pDONR223 0% 69.4% None (many diffs) n/a
7 ccsbBroad304_15050 pLX_304 29.1% 69.4% V5 (many diffs) n/a
8 TRCN0000475133 TCCACATGCAAACATATCTACTCA pLX_317 25.8% 69.4% V5 (many diffs) n/a
Download CSV