Transcript: Human XR_001748677.1

PREDICTED: Homo sapiens keratin 73 (KRT73), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRT73 (319101)
Length:
3365
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748677.1
NBCI Gene record:
KRT73 (319101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437659 ACGCAGCTTACACGAGCAAAG pLKO_005 2339 3UTR 100% 6.000 8.400 N KRT73 n/a
2 TRCN0000108252 GCCCGGAGCATCTCTTTCAAT pLKO.1 1768 3UTR 100% 5.625 7.875 N KRT73 n/a
3 TRCN0000108253 CGGAGAATATACCAACTCCGT pLKO.1 2946 3UTR 100% 0.066 0.092 N KRT73 n/a
4 TRCN0000108254 GCTTCAGCAGTCGGAGCCTTT pLKO.1 1733 3UTR 100% 1.350 0.945 N KRT73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09379 pDONR223 100% 39.6% None (many diffs) n/a
2 ccsbBroad304_09379 pLX_304 0% 39.6% V5 (many diffs) n/a
3 TRCN0000471794 CGTGTGGTGATATAGAGAAACATC pLX_317 26.4% 39.6% V5 (many diffs) n/a
4 ccsbBroadEn_13575 pDONR223 100% 33.5% None (many diffs) n/a
5 ccsbBroad304_13575 pLX_304 0% 33.5% V5 (many diffs) n/a
6 TRCN0000478787 CAGGTATTATTAGAGCATTGGAGC pLX_317 28% 33.5% V5 (many diffs) n/a
Download CSV