Transcript: Human XR_001748819.1

PREDICTED: Homo sapiens DEAH-box helicase 37 (DHX37), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHX37 (57647)
Length:
4592
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748819.1
NBCI Gene record:
DHX37 (57647)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419497 ATGAGAGCTCGATCCCGTATG pLKO_005 3757 3UTR 100% 6.000 8.400 N DHX37 n/a
2 TRCN0000050947 CCAATTCTCTCCGAAGAACAA pLKO.1 860 3UTR 100% 4.950 6.930 N DHX37 n/a
3 TRCN0000050945 CCTTCAAATGAAGGCGCTCAA pLKO.1 2230 3UTR 100% 0.405 0.567 N DHX37 n/a
4 TRCN0000050944 CCAGATCAACTTGGATCATTA pLKO.1 1702 3UTR 100% 13.200 10.560 N DHX37 n/a
5 TRCN0000424667 GAAATCGTGGAGACCACTAAG pLKO_005 3053 3UTR 100% 10.800 7.560 N DHX37 n/a
6 TRCN0000416325 TTGGTGACTTCGAGCAGTTTC pLKO_005 2169 3UTR 100% 10.800 7.560 N DHX37 n/a
7 TRCN0000050943 CCTCAGTTTGTCTCCCTTGTT pLKO.1 4338 3UTR 100% 4.950 3.465 N DHX37 n/a
8 TRCN0000050946 GACACGTTGAAGGGAGTTGAT pLKO.1 215 3UTR 100% 4.950 3.465 N DHX37 n/a
9 TRCN0000426507 AGAAGCAAGCACAGGTCTTTA pLKO_005 1902 3UTR 100% 13.200 7.920 N DHX37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12385 pDONR223 100% 2.4% None 1_3701del;3813_4592del n/a
2 ccsbBroad304_12385 pLX_304 0% 2.4% V5 1_3701del;3813_4592del n/a
3 TRCN0000471972 AGAATCGATCAATTGGAACCGTCC pLX_317 100% 2.4% V5 1_3701del;3813_4592del n/a
Download CSV