Transcript: Human XR_001748904.2

PREDICTED: Homo sapiens coiled-coil domain containing 62 (CCDC62), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC62 (84660)
Length:
2530
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748904.2
NBCI Gene record:
CCDC62 (84660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138158 CAGAGAATTGTCCGCCTCAAA pLKO.1 1729 3UTR 100% 4.950 3.960 N CCDC62 n/a
2 TRCN0000434458 ATTACGCTGTCATCCATATTC pLKO_005 1276 3UTR 100% 13.200 9.240 N CCDC62 n/a
3 TRCN0000428913 GAACAAGCTCTTACGACAATG pLKO_005 565 3UTR 100% 10.800 7.560 N CCDC62 n/a
4 TRCN0000137679 GAAAGCATCTGTGGCACACAA pLKO.1 1768 3UTR 100% 4.950 3.465 N CCDC62 n/a
5 TRCN0000134666 GTTCTTCATAAACGGCACTTA pLKO.1 2275 3UTR 100% 4.950 3.465 N CCDC62 n/a
6 TRCN0000138580 CGAAATCTCATGCTGCCAGAA pLKO.1 1578 3UTR 100% 4.050 2.835 N CCDC62 n/a
7 TRCN0000135312 GTCACTGTTTAAGGACCAGAA pLKO.1 1149 3UTR 100% 4.050 2.835 N CCDC62 n/a
8 TRCN0000133694 GAGAAGAAACAACAGATCGAT pLKO.1 1231 3UTR 100% 3.000 2.100 N CCDC62 n/a
9 TRCN0000135081 CACTATCGAGAAACAACGGAA pLKO.1 162 3UTR 100% 2.640 1.848 N CCDC62 n/a
10 TRCN0000138903 GATCAGATGGAAAGGTCCGAA pLKO.1 1561 3UTR 100% 2.640 1.848 N CCDC62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14311 pDONR223 100% 80.8% None (many diffs) n/a
2 ccsbBroad304_14311 pLX_304 0% 80.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479282 CGCTGTCTGTTCGAGCATTCCTTT pLX_317 20.1% 80.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV