Transcript: Human XR_001750184.2

PREDICTED: Homo sapiens dihydrolipoamide S-succinyltransferase (DLST), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLST (1743)
Length:
1160
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750184.2
NBCI Gene record:
DLST (1743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035427 CGCTCTTTGGAACACCCATTA pLKO.1 1079 3UTR 100% 10.800 7.560 N DLST n/a
2 TRCN0000311713 CGCTCTTTGGAACACCCATTA pLKO_005 1079 3UTR 100% 10.800 7.560 N DLST n/a
3 TRCN0000035428 CCAGCAAATGGCGTGATTGAA pLKO.1 393 3UTR 100% 5.625 3.375 N DLST n/a
4 TRCN0000349397 CCAGCAAATGGCGTGATTGAA pLKO_005 393 3UTR 100% 5.625 3.375 N DLST n/a
5 TRCN0000035424 GCCTGTTGTAAATGCAGTGAT pLKO.1 828 3UTR 100% 4.950 2.970 N DLST n/a
6 TRCN0000311638 GCCTGTTGTAAATGCAGTGAT pLKO_005 828 3UTR 100% 4.950 2.970 N DLST n/a
7 TRCN0000035425 CGAAAGAATGAACTTGCCATT pLKO.1 1006 3UTR 100% 4.050 2.430 N DLST n/a
8 TRCN0000311639 CGAAAGAATGAACTTGCCATT pLKO_005 1006 3UTR 100% 4.050 2.430 N DLST n/a
9 TRCN0000344755 CTAGGCTTCATGTCGGCATTT pLKO_005 775 3UTR 100% 10.800 5.400 Y DLST n/a
10 TRCN0000177977 GCAGATATTGAACGGACCATT pLKO.1 964 3UTR 100% 4.950 2.970 N Dlst n/a
11 TRCN0000340634 GCAGATATTGAACGGACCATT pLKO_005 964 3UTR 100% 4.950 2.970 N Dlst n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06100 pDONR223 100% 79.8% None (many diffs) n/a
2 ccsbBroad304_06100 pLX_304 0% 79.8% V5 (many diffs) n/a
3 TRCN0000465484 CGGAAGATATTGTACATCACAGAT pLX_317 28.2% 79.8% V5 (many diffs) n/a
Download CSV