Transcript: Human XR_001751341.2

PREDICTED: Homo sapiens poly(ADP-ribose) polymerase family member 16 (PARP16), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARP16 (54956)
Length:
1670
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751341.2
NBCI Gene record:
PARP16 (54956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422730 ACGAGCGAGAATCAAACATAG pLKO_005 1033 3UTR 100% 10.800 15.120 N PARP16 n/a
2 TRCN0000053171 CCATTGGTTTACCGTCATGAT pLKO.1 1186 3UTR 100% 4.950 6.930 N PARP16 n/a
3 TRCN0000440894 GACCCAGCCAACGCCAAATTT pLKO_005 713 3UTR 100% 15.000 10.500 N PARP16 n/a
4 TRCN0000336409 GAGAACGAGACCTAATCTATG pLKO_005 747 3UTR 100% 10.800 7.560 N Parp16 n/a
5 TRCN0000053170 CCAAAGGAGAACGAGACCTAA pLKO.1 741 3UTR 100% 4.950 3.465 N PARP16 n/a
6 TRCN0000053169 CCTCCTGGTGTATTCACAGAA pLKO.1 1120 3UTR 100% 4.950 3.465 N PARP16 n/a
7 TRCN0000053172 CCTGTTTGAAATTGAGTACTT pLKO.1 691 3UTR 100% 4.950 3.465 N PARP16 n/a
8 TRCN0000336341 ACTTGAGCCTGGCCCTCATTT pLKO_005 876 3UTR 100% 13.200 18.480 N Parp16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03496 pDONR223 100% 57.3% None (many diffs) n/a
2 ccsbBroad304_03496 pLX_304 0% 57.3% V5 (many diffs) n/a
3 TRCN0000471995 GTGACGTGGTTTACTCTACAAATT pLX_317 35.6% 57.3% V5 (many diffs) n/a
4 ccsbBroadEn_12121 pDONR223 100% 57% None (many diffs) n/a
5 ccsbBroad304_12121 pLX_304 0% 57% V5 (many diffs) n/a
6 TRCN0000467473 TGCCGCCCGGAACTAGAAACGCGG pLX_317 27.1% 57% V5 (many diffs) n/a
Download CSV