Transcript: Human XR_001751994.2

PREDICTED: Homo sapiens chromodomain helicase DNA binding protein 9 (CHD9), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHD9 (80205)
Length:
8380
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751994.2
NBCI Gene record:
CHD9 (80205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230235 GATCAATCCAGGGACTATAAA pLKO_005 2991 3UTR 100% 15.000 21.000 N CHD9 n/a
2 TRCN0000218966 TGCATACCAGCGTACTAATAA pLKO_005 5816 3UTR 100% 15.000 21.000 N CHD9 n/a
3 TRCN0000230236 TTCGTACGTGGACTGATATTA pLKO_005 3226 3UTR 100% 15.000 21.000 N CHD9 n/a
4 TRCN0000382457 CCGAGCTCTCTTAGCATATTG pLKO_005 5042 3UTR 100% 13.200 18.480 N CHD9 n/a
5 TRCN0000108086 GCTGGTAAATTGGTCCTTATT pLKO.1 3987 3UTR 100% 13.200 18.480 N CHD9 n/a
6 TRCN0000218227 ATCACATCCTCAGGGTAATTA pLKO_005 1472 3UTR 100% 15.000 10.500 N CHD9 n/a
7 TRCN0000381326 ATGACCTTGATCGGCAGTTTA pLKO_005 1747 3UTR 100% 13.200 9.240 N CHD9 n/a
8 TRCN0000380419 CAATCTGAAGAAGAGGTTAAA pLKO_005 2403 3UTR 100% 13.200 9.240 N CHD9 n/a
9 TRCN0000380165 CAATGATGTTGAGACGATTAA pLKO_005 3673 3UTR 100% 13.200 9.240 N CHD9 n/a
10 TRCN0000381271 GAACGTGTTCAACTGATTAAC pLKO_005 8124 3UTR 100% 13.200 9.240 N CHD9 n/a
11 TRCN0000108088 GCCTTATTTCAGGCCAATGAA pLKO.1 933 3UTR 100% 5.625 3.938 N CHD9 n/a
12 TRCN0000108087 CCCAATAAACTAGATGTGAAT pLKO.1 8088 3UTR 100% 4.950 3.465 N CHD9 n/a
13 TRCN0000108089 CGCATTGAACTTCTAAGGAAA pLKO.1 6225 3UTR 100% 4.950 3.465 N CHD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12681 pDONR223 100% 4.2% None 1_687del;1045_8380del n/a
2 ccsbBroad304_12681 pLX_304 0% 4.2% V5 1_687del;1045_8380del n/a
3 TRCN0000472257 TAGCGCCTGCTAATAAACTTCACC pLX_317 100% 4.2% V5 1_687del;1045_8380del n/a
Download CSV