Transcript: Human XR_001752586.1

PREDICTED: Homo sapiens N-sulfoglucosamine sulfohydrolase (SGSH), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGSH (6448)
Length:
4960
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752586.1
NBCI Gene record:
SGSH (6448)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336569 TAAGCTGCTCGTCCGGAAATT pLKO_005 485 3UTR 100% 13.200 18.480 N SGSH n/a
2 TRCN0000049504 CCACTTCAACTCCTTCGACAA pLKO.1 308 3UTR 100% 4.050 5.670 N SGSH n/a
3 TRCN0000049507 CGCGTACAACAACAGCGCCAT pLKO.1 134 3UTR 100% 0.720 1.008 N SGSH n/a
4 TRCN0000336633 CCGTGTACCCGTTTGACTTTG pLKO_005 409 3UTR 100% 10.800 8.640 N SGSH n/a
5 TRCN0000049503 GCGGAACATCACTAGAATTAA pLKO.1 467 3UTR 100% 15.000 10.500 N SGSH n/a
6 TRCN0000307455 GCGGAACATCACTAGAATTAA pLKO_005 467 3UTR 100% 15.000 10.500 N Sgsh n/a
7 TRCN0000049506 CTGAACCCTTACTGGTGTCAT pLKO.1 892 3UTR 100% 4.950 3.465 N SGSH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06943 pDONR223 100% 27.5% None (many diffs) n/a
2 ccsbBroad304_06943 pLX_304 0% 27.5% V5 (many diffs) n/a
3 TRCN0000466041 TCGGGATGGATTTGAGCCAAAACA pLX_317 23.6% 27.5% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 3.8% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 3.8% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 3.8% V5 (many diffs) n/a
Download CSV