Transcript: Human XR_001753167.2

PREDICTED: Homo sapiens trafficking protein particle complex 8 (TRAPPC8), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAPPC8 (22878)
Length:
5512
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753167.2
NBCI Gene record:
TRAPPC8 (22878)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330715 GTCAATGGTATACGAATATTA pLKO_005 5005 3UTR 100% 15.000 21.000 N TRAPPC8 n/a
2 TRCN0000330712 TCGACGTTTAGATCCCATAAT pLKO_005 3067 3UTR 100% 13.200 18.480 N TRAPPC8 n/a
3 TRCN0000059944 CCTGAAATGATTGGAGCTGAA pLKO.1 2768 3UTR 100% 4.050 5.670 N TRAPPC8 n/a
4 TRCN0000059947 CCTAATAATCAACTTCACGTA pLKO.1 536 3UTR 100% 2.640 3.696 N TRAPPC8 n/a
5 TRCN0000330713 CAGCTTCCTTTACCGTATATT pLKO_005 2357 3UTR 100% 15.000 10.500 N TRAPPC8 n/a
6 TRCN0000330716 ATAGTTGATCTTCGGCATAAA pLKO_005 4434 3UTR 100% 13.200 9.240 N TRAPPC8 n/a
7 TRCN0000059943 CCCTTGTACTATAACTTCAAA pLKO.1 1153 3UTR 100% 5.625 3.938 N TRAPPC8 n/a
8 TRCN0000059946 GCTGATGTAGATGTCATAGTT pLKO.1 4419 3UTR 100% 5.625 3.938 N TRAPPC8 n/a
9 TRCN0000059945 CCAGAACTTCAAATCAGGAAA pLKO.1 1622 3UTR 100% 4.950 3.465 N TRAPPC8 n/a
10 TRCN0000330714 TATTGGCAGGCCATCGATTTA pLKO_005 2061 3UTR 100% 13.200 7.920 N TRAPPC8 n/a
11 TRCN0000100912 CGACAGTTTATACAAGAGTTT pLKO.1 1412 3UTR 100% 4.950 3.960 N Trappc8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11640 pDONR223 100% 75.1% None (many diffs) n/a
2 ccsbBroad304_11640 pLX_304 0% 75.1% V5 (many diffs) n/a
3 TRCN0000469077 TTGCTATCCGGCCTCTAAAATGGG pLX_317 4.8% 75.1% V5 (many diffs) n/a
4 ccsbBroadEn_11639 pDONR223 100% 35.8% None (many diffs) n/a
5 ccsbBroad304_11639 pLX_304 0% 35.8% V5 (many diffs) n/a
Download CSV