Transcript: Human XR_001753696.1

PREDICTED: Homo sapiens VRK serine/threonine kinase 3 (VRK3), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VRK3 (51231)
Length:
2305
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753696.1
NBCI Gene record:
VRK3 (51231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010235 GTATCCAAGCGGCATTCAAAT pLKO.1 213 3UTR 100% 13.200 18.480 N VRK3 n/a
2 TRCN0000000911 AGTATCCAAGCGGCATTCAAA pLKO.1 212 3UTR 100% 5.625 7.875 N VRK3 n/a
3 TRCN0000350473 AGTATCCAAGCGGCATTCAAA pLKO_005 212 3UTR 100% 5.625 7.875 N VRK3 n/a
4 TRCN0000000910 CTCACTCAAACTGGATGCCAA pLKO.1 781 3UTR 100% 2.640 3.696 N VRK3 n/a
5 TRCN0000350465 CTCACTCAAACTGGATGCCAA pLKO_005 781 3UTR 100% 2.640 3.696 N VRK3 n/a
6 TRCN0000314891 CGGTGTTCACCAGGACAAATA pLKO_005 922 3UTR 100% 13.200 9.240 N VRK3 n/a
7 TRCN0000379666 GACTCAAGGCCTGCTGTTTAA pLKO_005 2037 3UTR 100% 13.200 9.240 N VRK3 n/a
8 TRCN0000381273 GATACTCATCAGTCCTGATTA pLKO_005 2115 3UTR 100% 13.200 9.240 N VRK3 n/a
9 TRCN0000197021 GTTTCTGCCATGGACAAATTG pLKO.1 1339 3UTR 100% 13.200 9.240 N VRK3 n/a
10 TRCN0000195576 CCCTACTGTGGAAATTCTTTG pLKO.1 239 3UTR 100% 10.800 7.560 N VRK3 n/a
11 TRCN0000000909 GATCTGCGTGTGTCTCCATAT pLKO.1 1927 3UTR 100% 10.800 7.560 N VRK3 n/a
12 TRCN0000380203 GGAATCCAGAACTTTCCATTT pLKO_005 1980 3UTR 100% 10.800 7.560 N VRK3 n/a
13 TRCN0000380047 CAAGCCCTGGAATGTGCATTC pLKO_005 2078 3UTR 100% 6.000 4.200 N VRK3 n/a
14 TRCN0000010563 ACTCAGGACCACAGAAGCAAA pLKO.1 756 3UTR 100% 4.950 3.465 N VRK3 n/a
15 TRCN0000195632 CCAACACTGAGGACATCATGA pLKO.1 1365 3UTR 100% 4.950 3.465 N VRK3 n/a
16 TRCN0000010236 GACAACCAGGGCATTCTCTAT pLKO.1 704 3UTR 100% 4.950 3.465 N VRK3 n/a
17 TRCN0000010228 GCAAGTCAACAAGTGGAAGAA pLKO.1 856 3UTR 100% 4.950 3.465 N VRK3 n/a
18 TRCN0000314963 GCAAGTCAACAAGTGGAAGAA pLKO_005 856 3UTR 100% 4.950 3.465 N VRK3 n/a
19 TRCN0000199854 GCCACTGGTTTCAGGATACTC pLKO.1 2101 3UTR 100% 4.950 3.465 N VRK3 n/a
20 TRCN0000199555 CCAGTTTCCCTCCCGTGAATG pLKO.1 2151 3UTR 100% 3.600 2.520 N VRK3 n/a
21 TRCN0000000912 CTCCTAAGAAAGTGAAATGGT pLKO.1 357 3UTR 100% 3.000 2.100 N VRK3 n/a
22 TRCN0000197020 GAGTTCATTAGCATGGACCTG pLKO.1 1244 3UTR 100% 2.160 1.512 N VRK3 n/a
23 TRCN0000010234 GCTGAAGTGGCTCTACGGGTT pLKO.1 1321 3UTR 100% 0.720 0.504 N VRK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487697 CAAACTTCGAGTGTAATCTAATCC pLX_317 6.9% 61.6% V5 (not translated due to prior stop codon) 1_181del;1399_1769del;1975_2305del n/a
2 ccsbBroadEn_15061 pDONR223 0% 53.6% None 1_181del;1418_2305del n/a
3 ccsbBroad304_15061 pLX_304 0% 53.6% V5 1_181del;1418_2305del n/a
4 TRCN0000470398 CGAAACCACCGTCCTGTGCAAGAA pLX_317 33.9% 53.6% V5 1_181del;1418_2305del n/a
Download CSV