Transcript: Human XR_001753769.2

PREDICTED: Homo sapiens elongation factor for RNA polymerase II (ELL), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELL (8178)
Length:
4165
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753769.2
NBCI Gene record:
ELL (8178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233539 GCTACAAGAACGACTTCAATG pLKO_005 1781 3UTR 100% 10.800 15.120 N ELL n/a
2 TRCN0000019211 GAGCTACAAGAACGACTTCAA pLKO.1 1779 3UTR 100% 4.950 6.930 N ELL n/a
3 TRCN0000233540 TAATGAGACTTGAGTCTATTT pLKO_005 2433 3UTR 100% 13.200 10.560 N ELL n/a
4 TRCN0000019210 CGCGCCAGACAGGATTCTGTT pLKO.1 129 3UTR 100% 1.650 1.320 N ELL n/a
5 TRCN0000238798 CGCCAGACAGGATTCTGTTTC pLKO_005 131 3UTR 100% 10.800 7.560 N ELL n/a
6 TRCN0000233537 CTGAGGCCATCTATCCGATTT pLKO_005 153 3UTR 100% 10.800 7.560 N ELL n/a
7 TRCN0000233538 AGAAGGTTCAGTTTCGGAAAC pLKO_005 478 3UTR 100% 6.000 4.200 N ELL n/a
8 TRCN0000019212 CCTGGGCAGCATACAGGACAA pLKO.1 335 3UTR 100% 1.350 0.945 N ELL n/a
9 TRCN0000019213 GCAAGAAGGTTCAGTTTCGGA pLKO.1 475 3UTR 100% 0.750 0.525 N ELL n/a
10 TRCN0000019209 GCCTGACTACTTGCTGAAGTA pLKO.1 1728 3UTR 100% 0.495 0.347 N ELL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11258 pDONR223 100% 6.3% None 1_3311del;3576_4165del n/a
2 ccsbBroad304_11258 pLX_304 0% 6.3% V5 1_3311del;3576_4165del n/a
3 TRCN0000466783 AGCCCGAATAGGCTCTTACCAAGC pLX_317 94.3% 6.3% V5 1_3311del;3576_4165del n/a
Download CSV