Transcript: Human XR_001753771.1

PREDICTED: Homo sapiens abhydrolase domain containing 17A (ABHD17A), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABHD17A (81926)
Length:
1804
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753771.1
NBCI Gene record:
ABHD17A (81926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424825 GCACAACGACATCGAGCTCTA pLKO_005 1496 3UTR 100% 4.050 5.670 N ABHD17A n/a
2 TRCN0000431561 CGCGTCTCCTGCATGTATGTT pLKO_005 698 3UTR 100% 5.625 4.500 N ABHD17A n/a
3 TRCN0000431982 GACGATGTACAGGCAACAGAG pLKO_005 1713 3UTR 100% 4.050 3.240 N ABHD17A n/a
4 TRCN0000243820 CTTCCGAGAGGAACCTCTATG pLKO_005 876 3UTR 100% 10.800 7.560 N ABHD17AP1 n/a
5 TRCN0000415147 ACAGAGCTACGCACTCCTTTC pLKO_005 1728 3UTR 100% 6.000 4.200 N ABHD17A n/a
6 TRCN0000243819 AGGACGAGGTGATCGACTTCT pLKO_005 1408 3UTR 100% 4.950 3.465 N ABHD17AP1 n/a
7 TRCN0000436744 CATCGAGCTCTACAGCCAGTA pLKO_005 1505 3UTR 100% 4.050 2.835 N ABHD17A n/a
8 TRCN0000075286 CACCAAGAAGACCTACTGCTT pLKO.1 1319 3UTR 100% 2.640 1.848 N ABHD17A n/a
9 TRCN0000426493 AGGTGTCCAAGATCACGTCTC pLKO_005 1363 3UTR 100% 2.250 1.575 N ABHD17A n/a
10 TRCN0000434446 TGCATGTATGTTCGCTGCGTG pLKO_005 707 3UTR 100% 2.160 1.512 N ABHD17A n/a
11 TRCN0000243818 AGATGAGCAGCTTCTACATTG pLKO_005 783 3UTR 100% 10.800 6.480 N ABHD17AP1 n/a
12 TRCN0000075285 CCAGATGAGCAGCTTCTACAT pLKO.1 781 3UTR 100% 4.950 2.970 N ABHD17A n/a
13 TRCN0000075284 CCACTGCAACATCTTCTCCTA pLKO.1 820 3UTR 100% 2.640 1.584 N ABHD17A n/a
14 TRCN0000432155 ACATCTTCTCCTACGACTACT pLKO_005 828 3UTR 100% 4.950 2.475 Y ABHD17A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04263 pDONR223 100% 51.5% None 1_406del;933_1173del;1578_1804del n/a
2 ccsbBroad304_04263 pLX_304 0% 51.5% V5 1_406del;933_1173del;1578_1804del n/a
3 TRCN0000478384 CTCTCTCTTGTATTCCTTTCAAGT pLX_317 29.2% 51.5% V5 1_406del;933_1173del;1578_1804del n/a
4 ccsbBroadEn_12734 pDONR223 100% 39.1% None (many diffs) n/a
5 ccsbBroad304_12734 pLX_304 0% 39.1% V5 (many diffs) n/a
6 TRCN0000465715 CAGCATGCTCTGCGTCTCATCCAG pLX_317 52% 39.1% V5 (many diffs) n/a
Download CSV