Transcript: Human XR_001754835.1

PREDICTED: Homo sapiens holocarboxylase synthetase (HLCS), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HLCS (3141)
Length:
5044
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754835.1
NBCI Gene record:
HLCS (3141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045783 CCGCAGGAAATGGGCTTAATA pLKO.1 1910 3UTR 100% 15.000 21.000 N HLCS n/a
2 TRCN0000233104 TGAAGTGGCCCAACGATATTT pLKO_005 2139 3UTR 100% 15.000 21.000 N HLCS n/a
3 TRCN0000045786 CCTACGTGTCTGAAGTAGAAA pLKO.1 1716 3UTR 100% 5.625 7.875 N HLCS n/a
4 TRCN0000233101 CAGACCTTCCCTACGATTATA pLKO_005 828 3UTR 100% 15.000 12.000 N HLCS n/a
5 TRCN0000233103 AGTATCAGGATATCAACTTAC pLKO_005 2115 3UTR 100% 10.800 7.560 N HLCS n/a
6 TRCN0000045787 GCCTGAACCTTCTCTTGAGAT pLKO.1 574 3UTR 100% 4.950 3.465 N HLCS n/a
7 TRCN0000045785 GCTGTGGATTTAATGTGACTA pLKO.1 2463 3UTR 100% 4.950 3.465 N HLCS n/a
8 TRCN0000045784 CCTACGATTATAGCAGCAGTT pLKO.1 837 3UTR 100% 4.050 2.835 N HLCS n/a
9 TRCN0000233102 TACCTCCCAGCTCCAACATAG pLKO_005 1452 3UTR 100% 0.000 0.000 N HLCS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06380 pDONR223 100% 43.1% None (many diffs) n/a
2 ccsbBroad304_06380 pLX_304 0% 43.1% V5 (many diffs) n/a
3 TRCN0000481180 TCCAGTAACTAACAAGCTTGTCTG pLX_317 20.9% 43.1% V5 (many diffs) n/a
Download CSV