Transcript: Human XR_001755206.2

PREDICTED: Homo sapiens TBC1 domain family member 22A (TBC1D22A), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D22A (25771)
Length:
3686
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755206.2
NBCI Gene record:
TBC1D22A (25771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437845 GGTTACCTTCCCGCCAATGTA pLKO_005 688 3UTR 100% 5.625 7.875 N TBC1D22A n/a
2 TRCN0000136013 GATTCTAGGAACGACGAAGTT pLKO.1 775 3UTR 100% 4.950 6.930 N TBC1D22A n/a
3 TRCN0000138538 CGAAGTTCACCAGGACACATA pLKO.1 789 3UTR 100% 4.950 3.960 N TBC1D22A n/a
4 TRCN0000418048 TGCCCAACCTGGGATTCAAAT pLKO_005 1119 3UTR 100% 13.200 9.240 N TBC1D22A n/a
5 TRCN0000138336 CGTGAGATGGAGGAAGGAAAT pLKO.1 1362 3UTR 100% 10.800 7.560 N TBC1D22A n/a
6 TRCN0000136151 GATCTCGTCACTCCTTTCTTT pLKO.1 949 3UTR 100% 5.625 3.938 N TBC1D22A n/a
7 TRCN0000438545 ATGAGCCCTGAAGCGTTGATC pLKO_005 838 3UTR 100% 4.950 3.465 N TBC1D22A n/a
8 TRCN0000138630 CAGGCAGATCCACATAGACAT pLKO.1 810 3UTR 100% 4.950 3.465 N TBC1D22A n/a
9 TRCN0000138434 CAGTGGATACGTTCAGGGTAT pLKO.1 924 3UTR 100% 4.050 2.835 N TBC1D22A n/a
10 TRCN0000138669 GACAACTACACCTTTGCCCAA pLKO.1 1105 3UTR 100% 2.160 1.512 N TBC1D22A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11765 pDONR223 100% 34.8% None (many diffs) n/a
2 ccsbBroad304_11765 pLX_304 0% 34.8% V5 (many diffs) n/a
3 TRCN0000472194 AAATCCCGAAGCATGGTTGGCACC pLX_317 38.7% 34.8% V5 (many diffs) n/a
Download CSV