Transcript: Human XR_001755264.2

PREDICTED: Homo sapiens eukaryotic translation initiation factor 4E nuclear import factor 1 (EIF4ENIF1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIF4ENIF1 (56478)
Length:
6358
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755264.2
NBCI Gene record:
EIF4ENIF1 (56478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427854 GGATCACCGTCTTAGCGATAA pLKO_005 1003 3UTR 100% 10.800 15.120 N EIF4ENIF1 n/a
2 TRCN0000153716 CGCCAAAGTTATCAGTGTAGA pLKO.1 3418 3UTR 100% 4.950 6.930 N EIF4ENIF1 n/a
3 TRCN0000151549 GAAGGTATAGTAGAGTGCAAT pLKO.1 1283 3UTR 100% 4.950 6.930 N EIF4ENIF1 n/a
4 TRCN0000175849 GCTTCGATGATAGAAGATGTT pLKO.1 1457 3UTR 100% 4.950 6.930 N Eif4enif1 n/a
5 TRCN0000340294 GCTTCGATGATAGAAGATGTT pLKO_005 1457 3UTR 100% 4.950 6.930 N Eif4enif1 n/a
6 TRCN0000155201 GCCGTAACCAACAATCGACAA pLKO.1 1901 3UTR 100% 4.050 5.670 N EIF4ENIF1 n/a
7 TRCN0000423445 CATGCTTGGCTTCGATGATAG pLKO_005 1449 3UTR 100% 10.800 8.640 N EIF4ENIF1 n/a
8 TRCN0000175042 GAACAAGATTATCGACCTAAA pLKO.1 2840 3UTR 100% 10.800 8.640 N Eif4enif1 n/a
9 TRCN0000153501 CAATCTTCTGAGTGGCCTTAT pLKO.1 2122 3UTR 100% 10.800 7.560 N EIF4ENIF1 n/a
10 TRCN0000154055 CGTAAGATGTACGAGAGCAAA pLKO.1 2609 3UTR 100% 4.950 3.465 N EIF4ENIF1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5498 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5881 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5881 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5881 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5883 3UTR 100% 4.950 2.475 Y CFLAR n/a
16 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5883 3UTR 100% 4.950 2.475 Y C19orf31 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5498 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08641 pDONR223 100% 46.4% None (many diffs) n/a
2 ccsbBroad304_08641 pLX_304 0% 46.4% V5 (many diffs) n/a
3 ccsbBroadEn_08640 pDONR223 100% 38.2% None (many diffs) n/a
4 ccsbBroad304_08640 pLX_304 0% 38.2% V5 (many diffs) n/a
Download CSV