Transcript: Human XR_001755385.1

PREDICTED: Homo sapiens RAB36, member RAS oncogene family (RAB36), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB36 (9609)
Length:
2956
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755385.1
NBCI Gene record:
RAB36 (9609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047788 CGCTTTGAGATTGCTGGGATT pLKO.1 630 3UTR 100% 4.050 5.670 N RAB36 n/a
2 TRCN0000047789 CCTAAGTGGTACACGCCGGAA pLKO.1 402 3UTR 100% 0.720 1.008 N RAB36 n/a
3 TRCN0000047790 GCCGCATGTGAGCAGGCCGAA pLKO.1 808 3UTR 100% 0.000 0.000 N RAB36 n/a
4 TRCN0000381825 CACACACACGGACAGGAATTT pLKO_005 1110 3UTR 100% 13.200 9.240 N RAB36 n/a
5 TRCN0000381996 GCACTGTGGTGATCCCATAAA pLKO_005 1324 3UTR 100% 13.200 9.240 N RAB36 n/a
6 TRCN0000381964 ACTTTGAAATTGAGCGCTTTG pLKO_005 616 3UTR 100% 6.000 4.200 N RAB36 n/a
7 TRCN0000382321 TTCCTCGTGGGAACCAAGAAG pLKO_005 772 3UTR 100% 4.950 3.465 N RAB36 n/a
8 TRCN0000047791 AGGTCGGCAATGGAGACCTAA pLKO.1 989 3UTR 100% 0.495 0.347 N RAB36 n/a
9 TRCN0000379781 ATTGCTGGGATTCCCTATAGC pLKO_005 639 3UTR 100% 4.950 2.970 N RAB36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 7.3% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 7.3% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 7.3% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 6.3% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 6.3% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 6.3% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% 2.1% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% 2.1% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2.1% V5 (many diffs) n/a
Download CSV