Transcript: Human XR_001756352.1

PREDICTED: Homo sapiens nuclear pore complex-interacting protein family member A7-like (LOC102724993), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724993 (102724993)
Length:
1377
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001756352.1
NBCI Gene record:
LOC102724993 (102724993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001756352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264027 CGTAGACAGGAAGGAATTAAA pLKO_005 376 3UTR 100% 15.000 7.500 Y PKD1P1 n/a
2 TRCN0000140226 GCCGTAGACAGGAAGGAATTA pLKO.1 374 3UTR 100% 13.200 6.600 Y NPIPA1 n/a
3 TRCN0000264025 TGGAAGTCCTTGGTTACTTAT pLKO_005 207 3UTR 100% 13.200 6.600 Y PKD1P1 n/a
4 TRCN0000145199 GAAACCAAAGTTCGAGCTAAA pLKO.1 436 3UTR 100% 10.800 5.400 Y NPIPA1 n/a
5 TRCN0000145534 CTGAGGAAACTAAGCATGAAA pLKO.1 535 3UTR 100% 5.625 2.813 Y NPIPA1 n/a
6 TRCN0000151687 CCTTAAATGATGCTCAGCTAA pLKO.1 1054 3UTR 100% 4.950 2.475 Y NPIPB7 n/a
7 TRCN0000141507 CTTCTGCAAGAAAGCCTCTTT pLKO.1 710 3UTR 100% 4.950 2.475 Y NPIPB15 n/a
8 TRCN0000142420 GAGGACTACTACAGATGCAAA pLKO.1 682 3UTR 100% 4.950 2.475 Y NPIPA1 n/a
9 TRCN0000144792 GTAAGATGAAGGTGACAACAA pLKO.1 461 3UTR 100% 4.950 2.475 Y NPIPA1 n/a
10 TRCN0000140729 GCTGGGATTTATCAGCCATCA pLKO.1 60 3UTR 100% 4.050 2.025 Y NPIPB15 n/a
11 TRCN0000145269 GTCTTTCCTGAAGACTATCTT pLKO.1 291 3UTR 100% 0.563 0.281 Y NPIPB15 n/a
12 TRCN0000264026 TACCTCACAGCTGAAACTTTA pLKO_005 1359 3UTR 100% 0.000 0.000 Y PKD1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001756352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16160 pDONR223 0% 46.4% None (many diffs) n/a
2 ccsbBroad304_16160 pLX_304 0% 46.4% V5 (many diffs) n/a
3 TRCN0000473627 ATCAATCAGAAAGTCAGCTAAGTC pLX_317 59.4% 46.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV