Transcript: Mouse XR_001778785.1

PREDICTED: Mus musculus leucine rich repeat containing 49 (Lrrc49), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc49 (102747)
Length:
3276
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778785.1
NBCI Gene record:
Lrrc49 (102747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178648 CAGTACCGCATGATTTCAATT pLKO.1 2425 3UTR 100% 13.200 18.480 N Lrrc49 n/a
2 TRCN0000430976 TAAGTCCTTCGCCTCGTAATA pLKO_005 672 3UTR 100% 13.200 18.480 N Lrrc49 n/a
3 TRCN0000168388 GCTCAAGAGTCATGGTACAAA pLKO.1 1505 3UTR 100% 5.625 7.875 N LRRC49 n/a
4 TRCN0000198795 CCATTAACAATGTCGCTCGAA pLKO.1 1778 3UTR 100% 2.640 3.696 N Lrrc49 n/a
5 TRCN0000418527 CAACGGCCTGGATTCACTAAC pLKO_005 1315 3UTR 100% 10.800 8.640 N Lrrc49 n/a
6 TRCN0000216277 CTAATCTACAGAGGCTAATAT pLKO.1 1053 3UTR 100% 15.000 10.500 N Lrrc49 n/a
7 TRCN0000217890 GAAACCCAGTGGTCAACTTTA pLKO.1 2261 3UTR 100% 13.200 9.240 N Lrrc49 n/a
8 TRCN0000419079 AGAAGTTCTGCAGGTTGTATG pLKO_005 2630 3UTR 100% 10.800 7.560 N Lrrc49 n/a
9 TRCN0000217172 CATTCACGTTCATCGAGTTTG pLKO.1 2090 3UTR 100% 10.800 7.560 N Lrrc49 n/a
10 TRCN0000198384 GAAAGGCTCTTTGGAATCTTA pLKO.1 2377 3UTR 100% 5.625 3.938 N Lrrc49 n/a
11 TRCN0000176668 CATGGAAATCAGATTACCAAA pLKO.1 1217 3UTR 100% 4.950 3.465 N Lrrc49 n/a
12 TRCN0000200354 GATGGCTGCTACTTCAGACTT pLKO.1 2819 3UTR 100% 4.950 3.465 N Lrrc49 n/a
13 TRCN0000200421 GCTGGGTCAGAAATGCTTCTT pLKO.1 3059 3UTR 100% 4.950 3.465 N Lrrc49 n/a
14 TRCN0000181250 CCTTAAATTCAGGGAGACCAA pLKO.1 2166 3UTR 100% 2.640 1.848 N Lrrc49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12095 pDONR223 100% 53.4% None (many diffs) n/a
2 ccsbBroad304_12095 pLX_304 0% 53.4% V5 (many diffs) n/a
3 TRCN0000479320 ACTCCCAGGACAATCGTCTAACCC pLX_317 19.3% 53.4% V5 (many diffs) n/a
Download CSV