Transcript: Mouse XR_001779328.1

PREDICTED: Mus musculus uncharacterized LOC108167692 (LOC108167692), ncRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm46136 (108167692)
Length:
7958
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779328.1
NBCI Gene record:
Gm46136 (108167692)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166364 CACACACACACACACACACAA pLKO.1 985 3UTR 100% 4.950 2.475 Y KAAG1 n/a
2 TRCN0000111413 GTGGAGAGTGTCACACCGAAA pLKO.1 7643 3UTR 100% 4.050 2.025 Y Polr2k n/a
3 TRCN0000332512 GTGGAGAGTGTCACACCGAAA pLKO_005 7643 3UTR 100% 4.050 2.025 Y Polr2k n/a
4 TRCN0000111414 GATAAAGTCCAGGGATCCCAT pLKO.1 7668 3UTR 100% 2.640 1.320 Y Polr2k n/a
5 TRCN0000332443 GATAAAGTCCAGGGATCCCAT pLKO_005 7668 3UTR 100% 2.640 1.320 Y Polr2k n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13922 pDONR223 100% 1.9% None (many diffs) n/a
2 ccsbBroad304_13922 pLX_304 0% 1.9% V5 (many diffs) n/a
3 TRCN0000472343 GATTGGCTTTTCCGTATGTTGTGT pLX_317 100% 1.9% V5 (many diffs) n/a
Download CSV