Transcript: Mouse XR_001779464.1

PREDICTED: Mus musculus glutamate receptor, ionotropic, kainate 2 (beta 2) (Grik2), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grik2 (14806)
Length:
3363
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779464.1
NBCI Gene record:
Grik2 (14806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100274 CGTTTATGACTCTTGGAATAA pLKO.1 2441 3UTR 100% 13.200 10.560 N Grik2 n/a
2 TRCN0000100271 GCCGTTTATGACTCTTGGAAT pLKO.1 2439 3UTR 100% 4.950 3.960 N Grik2 n/a
3 TRCN0000100273 GCATTCAGATTTGCTGTGAAT pLKO.1 1012 3UTR 100% 0.495 0.347 N Grik2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13864 pDONR223 100% 47.5% None (many diffs) n/a
2 ccsbBroad304_13864 pLX_304 0% 47.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471328 TCAAACTAGATTACAATTCGATTC pLX_317 18.9% 47.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10863 pDONR223 100% 27.1% None (many diffs) n/a
5 ccsbBroad304_10863 pLX_304 0% 27.1% V5 (many diffs) n/a
6 TRCN0000471009 TTGCTGATAGATCAATTCTGAAGC pLX_317 31.6% 27.1% V5 (many diffs) n/a
Download CSV