Transcript: Mouse XR_001779551.1

PREDICTED: Mus musculus cleavage and polyadenylation specific factor 6 (Cpsf6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpsf6 (432508)
Length:
12796
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779551.1
NBCI Gene record:
Cpsf6 (432508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216859 GGTGATTATGGGAGTGCTATT pLKO.1 1518 3UTR 100% 10.800 15.120 N Cpsf6 n/a
2 TRCN0000244314 GGTGATTATGGGAGTGCTATT pLKO_005 1518 3UTR 100% 10.800 15.120 N CPSF6 n/a
3 TRCN0000174746 GCGTAAAGAAAGCTCTAGTAT pLKO.1 8990 3UTR 100% 5.625 7.875 N Cpsf6 n/a
4 TRCN0000176401 CCGTTCATTCTTTGGGAGTAA pLKO.1 391 3UTR 100% 4.950 6.930 N Cpsf6 n/a
5 TRCN0000174773 GAATCGCATTGTATATTGGAA pLKO.1 331 3UTR 100% 3.000 4.200 N Cpsf6 n/a
6 TRCN0000237831 ATCGTTGCAAAGTTCTTATTA pLKO_005 1594 3UTR 100% 15.000 12.000 N CPSF6 n/a
7 TRCN0000000152 GAAATCTAACATGGTGGACAA pLKO.1 349 3UTR 100% 4.050 3.240 N CPSF6 n/a
8 TRCN0000216382 GCAACTTTATTACTGGTTATA pLKO.1 8241 3UTR 100% 13.200 9.240 N Cpsf6 n/a
9 TRCN0000217768 GCAATCTCAAGCAGTGCTATT pLKO.1 1470 3UTR 100% 10.800 7.560 N Cpsf6 n/a
10 TRCN0000175303 CCTGTTGTAACTCCATGCAAT pLKO.1 552 3UTR 100% 4.950 3.465 N Cpsf6 n/a
11 TRCN0000000151 CTGGTGATTATGGGAGTGCTA pLKO.1 1516 3UTR 100% 2.640 1.848 N CPSF6 n/a
12 TRCN0000193788 CCATCTGCAAATAATGGCGAT pLKO.1 207 3UTR 100% 2.160 1.512 N Cpsf6 n/a
13 TRCN0000237833 GTTGTAACTCCATGCAATAAA pLKO_005 555 3UTR 100% 15.000 12.000 N CPSF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11586 pDONR223 100% 12.8% None (many diffs) n/a
2 ccsbBroad304_11586 pLX_304 0% 12.8% V5 (many diffs) n/a
3 TRCN0000469395 ATTAGGCCTGGAATAATTAAGGAA pLX_317 22% 12.8% V5 (many diffs) n/a
4 ccsbBroadEn_11585 pDONR223 100% 10.3% None (many diffs) n/a
5 ccsbBroad304_11585 pLX_304 0% 10.3% V5 (many diffs) n/a
6 TRCN0000472490 TCGATTGCACTATGTTAGAATGAT pLX_317 31.4% 10.3% V5 (many diffs) n/a
Download CSV