Transcript: Mouse XR_001780413.1

PREDICTED: Mus musculus kinesin light chain 1 (Klc1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klc1 (16593)
Length:
7298
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780413.1
NBCI Gene record:
Klc1 (16593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100414 GACGCTGAAGTGCTTGAAGAA pLKO.1 323 3UTR 100% 4.950 6.930 N Klc1 n/a
2 TRCN0000100413 CGGCTGGTATAAAGCCTGCAA pLKO.1 1520 3UTR 100% 2.640 3.696 N Klc1 n/a
3 TRCN0000100410 CGTTGGATGATCTCTTCCCAA pLKO.1 694 3UTR 100% 2.640 2.112 N Klc1 n/a
4 TRCN0000417326 CAACGTGGCCAAGACCAAGAA pLKO_005 1304 3UTR 100% 4.950 3.465 N KLC3 n/a
5 TRCN0000100411 CCTGATGTTGCCAAACAGTTA pLKO.1 1176 3UTR 100% 4.950 3.465 N Klc1 n/a
6 TRCN0000100412 GCGCTGTCCAATCACCTGAAT pLKO.1 441 3UTR 100% 4.950 3.465 N Klc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00912 pDONR223 100% 19.8% None (many diffs) n/a
2 ccsbBroad304_00912 pLX_304 0% 19.8% V5 (many diffs) n/a
3 TRCN0000473946 GCCCCTGTGATTAGGGTCCGGGTG pLX_317 24.2% 19.8% V5 (many diffs) n/a
Download CSV