Transcript: Mouse XR_001781160.1

PREDICTED: Mus musculus adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 (Appl1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Appl1 (72993)
Length:
2173
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781160.1
NBCI Gene record:
Appl1 (72993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217195 CAAGCTATGCATCGGATTTAT pLKO.1 875 3UTR 100% 15.000 21.000 N Appl1 n/a
2 TRCN0000340819 TCAAGCTATGCATCGGATTTA pLKO_005 874 3UTR 100% 13.200 18.480 N Appl1 n/a
3 TRCN0000217598 GATCATGATGCCGCAATTAAT pLKO.1 1166 3UTR 100% 15.000 10.500 N Appl1 n/a
4 TRCN0000215754 GTTTCCCATCAATCGAAATTT pLKO.1 1561 3UTR 100% 15.000 10.500 N Appl1 n/a
5 TRCN0000340818 TGATCATGATGCCGCAATTAA pLKO_005 1165 3UTR 100% 15.000 10.500 N Appl1 n/a
6 TRCN0000173555 GCAGCAGACAATAGAAGACTT pLKO.1 1492 3UTR 100% 4.950 3.465 N Appl1 n/a
7 TRCN0000176173 GCAGTACTTTCAACTCAACTT pLKO.1 1052 3UTR 100% 4.950 3.465 N Appl1 n/a
8 TRCN0000352539 GCAGTACTTTCAACTCAACTT pLKO_005 1052 3UTR 100% 4.950 3.465 N Appl1 n/a
9 TRCN0000173135 CGAAGAGAAATGGATGGTGAT pLKO.1 1460 3UTR 100% 4.050 2.835 N Appl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07982 pDONR223 100% 45.7% None (many diffs) n/a
2 ccsbBroad304_07982 pLX_304 0% 45.7% V5 (many diffs) n/a
3 TRCN0000479487 CTAATTCACCGCTTTGAGGTGACA pLX_317 17.9% 45.7% V5 (many diffs) n/a
Download CSV