Transcript: Mouse XR_001781571.1

PREDICTED: Mus musculus family with sequence similarity 118, member A (Fam118a), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam118a (73225)
Length:
2772
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781571.1
NBCI Gene record:
Fam118a (73225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279046 CTGGATCCATCGGGCTATAAA pLKO_005 840 3UTR 100% 15.000 21.000 N Fam118a n/a
2 TRCN0000279060 ACACTTCGGGACCAGATATTC pLKO_005 945 3UTR 100% 13.200 18.480 N Fam118a n/a
3 TRCN0000193261 CCACGGTTCATATTAAGATTT pLKO.1 2326 3UTR 100% 13.200 18.480 N Fam118a n/a
4 TRCN0000278993 CCACGGTTCATATTAAGATTT pLKO_005 2326 3UTR 100% 13.200 18.480 N Fam118a n/a
5 TRCN0000379319 GCACCACCTTACTGGGTAATG pLKO_005 1192 3UTR 100% 10.800 15.120 N Fam118a n/a
6 TRCN0000173280 GCCAAATAAGGTGGACTTGGA pLKO.1 989 3UTR 100% 2.640 3.696 N Fam118a n/a
7 TRCN0000194380 CCATGATCTGATCCGGAAGAT pLKO.1 509 3UTR 100% 4.950 3.960 N Fam118a n/a
8 TRCN0000278995 AGTGGGCAAGAGGCCATATTA pLKO_005 766 3UTR 100% 15.000 10.500 N Fam118a n/a
9 TRCN0000375612 AGGACCTGCTCTTGGTCATTG pLKO_005 319 3UTR 100% 10.800 7.560 N Fam118a n/a
10 TRCN0000217595 GAATGACAGAGCTCTACTATG pLKO.1 1649 3UTR 100% 10.800 7.560 N Fam118a n/a
11 TRCN0000173733 CGTGCCAAATAAGGTGGACTT pLKO.1 986 3UTR 100% 4.050 2.835 N Fam118a n/a
12 TRCN0000174961 GAAGACCATTTCTTTAAGCAT pLKO.1 1038 3UTR 100% 3.000 2.100 N Fam118a n/a
13 TRCN0000193441 GAGTTCTTCATATTCATGGTT pLKO.1 793 3UTR 100% 3.000 2.100 N Fam118a n/a
14 TRCN0000297596 GAGTTCTTCATATTCATGGTT pLKO_005 793 3UTR 100% 3.000 2.100 N Fam118a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08451 pDONR223 100% 33.2% None (many diffs) n/a
2 ccsbBroad304_08451 pLX_304 0% 33.2% V5 (many diffs) n/a
3 TRCN0000480532 TAGCATGTCAGCTTCCGAGAGTTT pLX_317 39.1% 33.2% V5 (many diffs) n/a
Download CSV