Transcript: Mouse XR_001781792.1

PREDICTED: Mus musculus peptidase domain containing associated with muscle regeneration 1 (Pamr1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pamr1 (210622)
Length:
2740
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781792.1
NBCI Gene record:
Pamr1 (210622)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056042 CCAGGTTGTACCATCTTTGAA pLKO.1 508 3UTR 100% 5.625 7.875 N PAMR1 n/a
2 TRCN0000031450 CCAAGAGAGTACACGGTCATT pLKO.1 328 3UTR 100% 4.950 3.465 N Pamr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02880 pDONR223 100% 40.6% None (many diffs) n/a
2 ccsbBroad304_02880 pLX_304 0% 40.6% V5 (many diffs) n/a
3 TRCN0000477550 GGCTCTTTACCACCTTGGTCTCTG pLX_317 17.5% 40.6% V5 (many diffs) n/a
Download CSV