Transcript: Mouse XR_001781796.1

PREDICTED: Mus musculus proline dehydrogenase (Prodh), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prodh (19125)
Length:
1607
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781796.1
NBCI Gene record:
Prodh (19125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041931 GAGACGGTTCTTCCATCAAAT pLKO.1 885 3UTR 100% 13.200 18.480 N Prodh n/a
2 TRCN0000256401 ACCACAGGTGCCTTAACTATG pLKO_005 1539 3UTR 100% 10.800 8.640 N Prodh n/a
3 TRCN0000256403 AGATGGCAGTGGAGCAAATAA pLKO_005 630 3UTR 100% 15.000 10.500 N Prodh n/a
4 TRCN0000256402 AGGGCAGCAGAGATCGGTTAT pLKO_005 1475 3UTR 100% 10.800 7.560 N Prodh n/a
5 TRCN0000256399 CAAAGGATGTTCGAGAGATTG pLKO_005 427 3UTR 100% 10.800 7.560 N Prodh n/a
6 TRCN0000041930 GTTGGCTTTATCCTGGACTAT pLKO.1 535 3UTR 100% 4.950 3.465 N Prodh n/a
7 TRCN0000041928 GCAGCAGAGATCGGTTATGAA pLKO.1 1478 3UTR 100% 5.625 3.938 N Prodh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06779 pDONR223 100% 51.4% None (many diffs) n/a
2 ccsbBroad304_06779 pLX_304 0% 51.4% V5 (many diffs) n/a
3 TRCN0000492052 CGACCCACTTGCTACGAGTGGATC pLX_317 29.3% 51.4% V5 (many diffs) n/a
Download CSV