Transcript: Mouse XR_001781889.1

PREDICTED: Mus musculus uncharacterized LOC108168281 (LOC108168281), ncRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC108168281 (108168281)
Length:
2887
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781889.1
NBCI Gene record:
LOC108168281 (108168281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125360 GCTGACAATGAGGTAGATGAA pLKO.1 1166 3UTR 100% 4.950 2.475 Y Ptma n/a
2 TRCN0000125359 CTGTACTATAAGTAGTTGGTT pLKO.1 1864 3UTR 100% 3.000 1.500 Y Ptma n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01339 pDONR223 100% 9.3% None (many diffs) n/a
2 ccsbBroad304_01339 pLX_304 0% 9.3% V5 (many diffs) n/a
3 TRCN0000475496 AATGTAGACTACCTTGACCGGGAC pLX_317 64.5% 9.3% V5 (many diffs) n/a
4 ccsbBroadEn_15553 pDONR223 0% 9.3% None (many diffs) n/a
5 ccsbBroad304_15553 pLX_304 0% 9.3% V5 (many diffs) n/a
6 TRCN0000478994 AAGACCGGGAGATGACTCTCGTTT pLX_317 100% 9.3% V5 (many diffs) n/a
Download CSV