Transcript: Mouse XR_001782382.1

PREDICTED: Mus musculus ATPase, class II, type 9B (Atp9b), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp9b (50771)
Length:
4562
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782382.1
NBCI Gene record:
Atp9b (50771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311201 TCCCATAAGTCTGCGAGTAAA pLKO_005 1460 3UTR 100% 13.200 18.480 N Atp9b n/a
2 TRCN0000304963 ACGGACACTATGGACGAAATC pLKO_005 1674 3UTR 100% 10.800 15.120 N Atp9b n/a
3 TRCN0000101562 GATTGATGAATTTCGACGTTT pLKO.1 731 3UTR 100% 4.950 6.930 N Atp9b n/a
4 TRCN0000101563 CGATTGATGAATTTCGACGTT pLKO.1 730 3UTR 100% 2.640 3.696 N Atp9b n/a
5 TRCN0000101561 GCTCACAGTTTGTACCAGCAT pLKO.1 637 3UTR 100% 2.640 2.112 N Atp9b n/a
6 TRCN0000434860 GTAATAGGTGTTGTCATTTAT pLKO_005 1236 3UTR 100% 15.000 10.500 N ATP9B n/a
7 TRCN0000304962 GTTGCTGTGATTGGCTAATAA pLKO_005 430 3UTR 100% 15.000 10.500 N Atp9b n/a
8 TRCN0000304961 AGCTGACAAAGGCGCTATTTC pLKO_005 1336 3UTR 100% 13.200 9.240 N Atp9b n/a
9 TRCN0000101560 CGTCCTCTTCAGATGCAGTTT pLKO.1 3892 3UTR 100% 4.950 3.465 N Atp9b n/a
10 TRCN0000315562 CGTCCTCTTCAGATGCAGTTT pLKO_005 3892 3UTR 100% 4.950 3.465 N Atp9b n/a
11 TRCN0000101564 GCGATAAACTGGAAACAGCTA pLKO.1 2500 3UTR 100% 2.640 1.848 N Atp9b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16162 pDONR223 0% 8.1% None (many diffs) n/a
2 ccsbBroad304_16162 pLX_304 0% 8.1% V5 (many diffs) n/a
3 TRCN0000481472 TCATAGCGTGATGCCATTGCCAGA pLX_317 82.2% 8.1% V5 (many diffs) n/a
Download CSV