Transcript: Mouse XR_001783140.1

PREDICTED: Mus musculus KH domain containing, RNA binding, signal transduction associated 2 (Khdrbs2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Khdrbs2 (170771)
Length:
2261
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783140.1
NBCI Gene record:
Khdrbs2 (170771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783140.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102330 CCTCCTCAAAGACAATTCATA pLKO.1 1301 3UTR 100% 5.625 7.875 N Khdrbs2 n/a
2 TRCN0000102334 AGACCTATGAGGCTTATGATA pLKO.1 1079 3UTR 100% 5.625 4.500 N Khdrbs2 n/a
3 TRCN0000102331 GCTCTCTGAAAGAGTATTGAT pLKO.1 408 3UTR 100% 5.625 3.938 N Khdrbs2 n/a
4 TRCN0000102332 CCGGGAGTTGTCTTACTTGAA pLKO.1 747 3UTR 100% 4.950 3.465 N Khdrbs2 n/a
5 TRCN0000102333 CTGGCGGAAGAAATTGAGAAA pLKO.1 313 3UTR 100% 4.950 3.465 N Khdrbs2 n/a
6 TRCN0000016893 CCTGACTACAATGATGAAATT pLKO.1 712 3UTR 100% 13.200 7.920 N KHDRBS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783140.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09825 pDONR223 100% 42.2% None (many diffs) n/a
2 ccsbBroad304_09825 pLX_304 0% 42.2% V5 (many diffs) n/a
3 TRCN0000468185 TTTTAGCTTTGTCAGTAAAATCGA pLX_317 39.6% 42.2% V5 (many diffs) n/a
Download CSV