Transcript: Mouse XR_001783717.1

PREDICTED: Mus musculus major facilitator superfamily domain containing 4A (Mfsd4a), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mfsd4a (213006)
Length:
2280
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783717.1
NBCI Gene record:
Mfsd4a (213006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329070 GAGGACATCCTCCAGTATAAA pLKO_005 1296 3UTR 100% 15.000 12.000 N Mfsd4a n/a
2 TRCN0000329010 TGCCATGACGTGAAGGTATTG pLKO_005 452 3UTR 100% 10.800 8.640 N Mfsd4a n/a
3 TRCN0000190351 CGTATCCTATGCCTTCTGGAT pLKO.1 793 3UTR 100% 2.640 2.112 N Mfsd4a n/a
4 TRCN0000329012 ATGCAGTTGGTGAGGATATAC pLKO_005 530 3UTR 100% 13.200 9.240 N Mfsd4a n/a
5 TRCN0000190440 CTGGATCATGGCTCTCATCAA pLKO.1 808 3UTR 100% 4.950 3.465 N Mfsd4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09658 pDONR223 100% 51.2% None (many diffs) n/a
2 ccsbBroad304_09658 pLX_304 0% 51.2% V5 (many diffs) n/a
3 TRCN0000478122 TCCTTATCATACGCTCACACGTCC pLX_317 1.7% 51.2% V5 (many diffs) n/a
Download CSV