Transcript: Mouse XR_001784491.1

PREDICTED: Mus musculus potassium channel, subfamily T, member 2 (Kcnt2), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnt2 (240776)
Length:
3805
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784491.1
NBCI Gene record:
Kcnt2 (240776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253223 ATCCAAGACTACAGGATTATT pLKO_005 1635 3UTR 100% 15.000 21.000 N Kcnt2 n/a
2 TRCN0000265354 TGTACCTCTCAGGGCATATTA pLKO_005 2893 3UTR 100% 15.000 21.000 N Kcnt2 n/a
3 TRCN0000265357 ATTGGATAACCCGCCAGATAT pLKO_005 2950 3UTR 100% 13.200 9.240 N Kcnt2 n/a
4 TRCN0000056255 CCTTTATGTTTCGACTGCCTT pLKO.1 3309 3UTR 100% 2.640 1.848 N KCNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13606 pDONR223 100% 62.2% None (many diffs) n/a
2 ccsbBroad304_13606 pLX_304 0% 62.2% V5 (many diffs) n/a
Download CSV