Transcript: Mouse XR_001784601.1

PREDICTED: Mus musculus circadian locomotor output cycles kaput (Clock), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clock (12753)
Length:
9941
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784601.1
NBCI Gene record:
Clock (12753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306475 GTGCTTCAGATGTCCATTAAA pLKO_005 3257 3UTR 100% 15.000 12.000 N Clock n/a
2 TRCN0000095686 CGGATGATAGAGGCAAATATT pLKO.1 2145 3UTR 100% 15.000 10.500 N Clock n/a
3 TRCN0000095688 GAGAACATTCAGAGGTTTATA pLKO.1 1035 3UTR 100% 15.000 10.500 N Clock n/a
4 TRCN0000095687 CACGGATGATAGAGGCAAATA pLKO.1 2143 3UTR 100% 13.200 9.240 N Clock n/a
5 TRCN0000354150 CACGGATGATAGAGGCAAATA pLKO_005 2143 3UTR 100% 13.200 9.240 N Clock n/a
6 TRCN0000306420 CAGGACAGACAGATAAGATTT pLKO_005 2619 3UTR 100% 13.200 9.240 N Clock n/a
7 TRCN0000306474 CTTCAGCAGTCAGTCCATAAA pLKO_005 1990 3UTR 100% 13.200 9.240 N Clock n/a
8 TRCN0000311544 GGGAACATCAGGCTATGATTA pLKO_005 1468 3UTR 100% 13.200 9.240 N Clock n/a
9 TRCN0000095684 CCACAGTTTAAGAGCATCATT pLKO.1 6916 3UTR 100% 5.625 3.938 N Clock n/a
10 TRCN0000095685 GCACCACCAATAATAGGCTAT pLKO.1 1430 3UTR 100% 4.050 2.835 N Clock n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02201 pDONR223 100% 22.9% None (many diffs) n/a
2 ccsbBroad304_02201 pLX_304 26.6% 22.9% V5 (many diffs) n/a
3 TRCN0000477413 GTCAACCAAAAGGACTTGCGATCT pLX_317 20.4% 22.9% V5 (many diffs) n/a
Download CSV