Transcript: Human XR_002956265.1

PREDICTED: Homo sapiens E2F transcription factor 3 (E2F3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
E2F3 (1871)
Length:
4529
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956265.1
NBCI Gene record:
E2F3 (1871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433255 GTCTTTGAGGTCTGCTAATAT pLKO_005 1685 3UTR 100% 15.000 21.000 N E2F3 n/a
2 TRCN0000413931 GACTTCATGTGTAGTTGATTA pLKO_005 1228 3UTR 100% 13.200 18.480 N E2F3 n/a
3 TRCN0000429171 ACGAAGTCCAGATAGTCCAAA pLKO_005 604 3UTR 100% 4.950 6.930 N E2F3 n/a
4 TRCN0000412779 ACGCGGTATGATACGTCTCTT pLKO_005 650 3UTR 100% 4.950 6.930 N E2F3 n/a
5 TRCN0000013807 CCAACTCAGGACATAGCGATT pLKO.1 995 3UTR 100% 4.050 5.670 N E2F3 n/a
6 TRCN0000238764 CAAGGGCCCATTGAGGTTTAC pLKO_005 874 3UTR 100% 10.800 7.560 N E2f3 n/a
7 TRCN0000432734 CCAACCTAGAAGGACCGTTTG pLKO_005 1094 3UTR 100% 6.000 4.200 N E2F3 n/a
8 TRCN0000412996 AGATCCTCACCACGAACACTT pLKO_005 297 3UTR 100% 4.950 3.465 N E2F3 n/a
9 TRCN0000013803 CCCGCTTTACTCTTCAGGAAT pLKO.1 2661 3UTR 100% 4.950 3.465 N E2F3 n/a
10 TRCN0000013804 CCTCATTAAGAAGAAGTCTAA pLKO.1 808 3UTR 100% 4.950 3.465 N E2F3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10793 pDONR223 100% 8.8% None 1_3031del;3431_4529del n/a
2 ccsbBroad304_10793 pLX_304 0% 8.8% V5 1_3031del;3431_4529del n/a
3 TRCN0000479119 TCTGCCGGTATATATCTTAAGCCA pLX_317 100% 8.8% V5 1_3031del;3431_4529del n/a
Download CSV