Transcript: Human XR_002956480.1

PREDICTED: Homo sapiens limb development membrane protein 1 (LMBR1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMBR1 (64327)
Length:
7890
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956480.1
NBCI Gene record:
LMBR1 (64327)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421142 GCCGCAAGCATGGAATCTTTA pLKO_005 716 3UTR 100% 13.200 18.480 N LMBR1 n/a
2 TRCN0000422150 TGGTACTAAGTGAAGCTTATT pLKO_005 1921 3UTR 100% 13.200 18.480 N LMBR1 n/a
3 TRCN0000427672 TTCTTCTTGCGTTACTCATTC pLKO_005 654 3UTR 100% 10.800 8.640 N LMBR1 n/a
4 TRCN0000421860 ATTTGCTCATGTTGGTAAATA pLKO_005 1763 3UTR 100% 15.000 10.500 N LMBR1 n/a
5 TRCN0000083462 GAGTTCTATCTACCCTATTTA pLKO.1 749 3UTR 100% 15.000 10.500 N LMBR1 n/a
6 TRCN0000083459 GCTGTCTTCATCGGTGGAATA pLKO.1 949 3UTR 100% 10.800 7.560 N LMBR1 n/a
7 TRCN0000417531 TGCCATTCTCTACGTTGTTTC pLKO_005 274 3UTR 100% 10.800 7.560 N LMBR1 n/a
8 TRCN0000083460 CCACGATATGTTTCCTTCTTT pLKO.1 252 3UTR 100% 5.625 3.938 N LMBR1 n/a
9 TRCN0000083458 CCAGTGTTTAATACACTTGTA pLKO.1 2269 3UTR 100% 0.495 0.347 N LMBR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08851 pDONR223 100% 16.2% None (many diffs) n/a
2 ccsbBroad304_08851 pLX_304 0% 16.2% V5 (many diffs) n/a
3 TRCN0000475016 GGGCAATCCTAGAGCGGTCAAGTG pLX_317 19.5% 16.2% V5 (many diffs) n/a
Download CSV