Transcript: Human XR_002956790.1

PREDICTED: Homo sapiens EGF like domain multiple 7 (EGFL7), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EGFL7 (51162)
Length:
6166
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956790.1
NBCI Gene record:
EGFL7 (51162)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956790.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053659 GCACCTACCGAACCATCTATA pLKO.1 5140 3UTR 100% 13.200 18.480 N EGFL7 n/a
2 TRCN0000372058 TGCAAGAAAGACTCGTGACTG pLKO_005 5757 3UTR 100% 4.050 5.670 N EGFL7 n/a
3 TRCN0000053661 AGGAGTGGACAGTGCAATGAA pLKO.1 5522 3UTR 100% 5.625 3.938 N EGFL7 n/a
4 TRCN0000053658 GCCAGTCAGATGTGGATGAAT pLKO.1 5353 3UTR 100% 5.625 3.938 N EGFL7 n/a
5 TRCN0000053662 CGAGCAGATTTCCTTCCTGGA pLKO.1 5714 3UTR 100% 2.160 1.512 N EGFL7 n/a
6 TRCN0000053660 CGGTACACTCTGTGTGCCCAA pLKO.1 5468 3UTR 100% 0.720 0.504 N EGFL7 n/a
7 TRCN0000372114 CAGTTACTGGTGCCAGTGTTG pLKO_005 5423 3UTR 100% 4.050 2.430 N EGFL7 n/a
8 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 1967 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956790.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08236 pDONR223 100% 12.9% None (many diffs) n/a
2 ccsbBroad304_08236 pLX_304 0% 12.9% V5 (many diffs) n/a
3 TRCN0000474432 AAATTCCAGCTATTAGCTTCGAGT pLX_317 48.7% 12.9% V5 (many diffs) n/a
Download CSV