Transcript: Human XR_002957015.1

PREDICTED: Homo sapiens cilia and flagella associated protein 43 (CFAP43), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP43 (80217)
Length:
7374
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957015.1
NBCI Gene record:
CFAP43 (80217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263901 CGGCCGAAAGATGATCTATAT pLKO_005 616 3UTR 100% 13.200 18.480 N CFAP43 n/a
2 TRCN0000263899 GTGTATCCGAGACGTTTATAC pLKO_005 1872 3UTR 100% 13.200 18.480 N CFAP43 n/a
3 TRCN0000263900 TGGTAGTCTGAGTACTGATTT pLKO_005 2823 3UTR 100% 13.200 18.480 N CFAP43 n/a
4 TRCN0000167473 GCTTGTGTAAGCAAGATTTAT pLKO.1 1147 3UTR 100% 15.000 12.000 N CFAP43 n/a
5 TRCN0000263898 TATGAGGCTCTGATTAGTATT pLKO_005 6740 3UTR 100% 13.200 9.240 N CFAP43 n/a
6 TRCN0000167763 GCAAAGATGATAAAGGATGTA pLKO.1 2467 3UTR 100% 4.950 3.465 N CFAP43 n/a
7 TRCN0000172640 GCCACAAGTTTCCACAACCTT pLKO.1 1566 3UTR 100% 3.000 2.100 N CFAP43 n/a
8 TRCN0000263897 ACAAGGCCAAATCAATCATTT pLKO_005 7142 3UTR 100% 13.200 7.920 N CFAP43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14282 pDONR223 100% 33.5% None (many diffs) n/a
2 ccsbBroad304_14282 pLX_304 0% 33.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477225 ATACCCGATGGGCTAGCAATCACC pLX_317 10.7% 33.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV