Transcript: Human XR_002957155.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP4K2 (5871)
Length:
5300
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957155.1
NBCI Gene record:
MAP4K2 (5871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199305 CCGACGCCTCTGCAATAACTG pLKO.1 2850 3UTR 100% 1.650 2.310 N MAP4K2 n/a
2 TRCN0000002237 CGCCCAAACTGAGAGATAAGA pLKO.1 797 3UTR 100% 5.625 4.500 N MAP4K2 n/a
3 TRCN0000197117 GCTGAAGGTCAGAAGTAATCC pLKO.1 2792 3UTR 100% 4.950 3.960 N MAP4K2 n/a
4 TRCN0000002233 CAGGAGATTTACCATGCCACT pLKO.1 394 3UTR 100% 2.160 1.728 N MAP4K2 n/a
5 TRCN0000002235 CGGTATTTAAGAGAGAACTAT pLKO.1 3031 3UTR 100% 5.625 3.938 N MAP4K2 n/a
6 TRCN0000002234 CCCTGACCAAGAATCCTAAGA pLKO.1 857 3UTR 100% 4.950 3.465 N MAP4K2 n/a
7 TRCN0000196641 GATGTCAAACTGGCTGACTTT pLKO.1 544 3UTR 100% 4.950 3.465 N MAP4K2 n/a
8 TRCN0000195052 CAGTTTCACCAGGTGAAATTT pLKO.1 1090 3UTR 100% 1.500 1.050 N MAP4K2 n/a
9 TRCN0000199054 CGCCTGCTTCTCCAAGGTCTT pLKO.1 1632 3UTR 100% 1.350 0.945 N MAP4K2 n/a
10 TRCN0000002236 ACCTGAGCTGACCTTTGATTT pLKO.1 2425 3UTR 100% 13.200 7.920 N MAP4K2 n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5071 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489563 ACTGCTTTGCCCAAGCATGATCTT pLX_317 15.4% 46.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487902 TCATCCTTGACTCCCCAGTACCCG pLX_317 8.7% 46.2% V5 (many diffs) n/a
3 ccsbBroadEn_11085 pDONR223 100% 45.8% None (many diffs) n/a
4 ccsbBroad304_11085 pLX_304 0% 45.8% V5 (many diffs) n/a
5 ccsbBroadEn_14823 pDONR223 0% 45.8% None (many diffs) n/a
6 ccsbBroad304_14823 pLX_304 0% 45.8% V5 (many diffs) n/a
7 TRCN0000474639 TACTGTCCCAAACGGCTAAGTACA pLX_317 15.5% 45.8% V5 (many diffs) n/a
8 TRCN0000488749 ATAAGTAATATTGATTAAGTAGCT pLX_317 13.4% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV