Transcript: Human XR_002957346.1

PREDICTED: Homo sapiens RIC8 guanine nucleotide exchange factor B (RIC8B), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIC8B (55188)
Length:
1601
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957346.1
NBCI Gene record:
RIC8B (55188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230248 CTGCGACTAGCCAAGCTAAAT pLKO_005 145 3UTR 100% 13.200 18.480 N RIC8B n/a
2 TRCN0000230249 GAATCGGCCATAGACCATAAT pLKO_005 493 3UTR 100% 13.200 18.480 N RIC8B n/a
3 TRCN0000230250 TTCTCATCAGTTCCGTGTAAT pLKO_005 615 3UTR 100% 13.200 18.480 N RIC8B n/a
4 TRCN0000219033 GATGAACTGCCCAGTAATAAA pLKO_005 805 3UTR 100% 15.000 10.500 N RIC8B n/a
5 TRCN0000006464 CCAGTTATTGTGGAGTCATTA pLKO.1 202 3UTR 100% 13.200 9.240 N RIC8B n/a
6 TRCN0000006466 GCTCTCTTCAATGTGACGGTA pLKO.1 565 3UTR 100% 2.640 1.848 N RIC8B n/a
7 TRCN0000418668 ACTTGTCAACATGCTTGATAA pLKO_005 1410 3UTR 100% 13.200 7.920 N Ric8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12180 pDONR223 100% 90.2% None (many diffs) n/a
2 ccsbBroad304_12180 pLX_304 0% 90.2% V5 (many diffs) n/a
3 TRCN0000477167 ACGTCCTACCCTAAGCCCTGGAGT pLX_317 19.1% 90.2% V5 (many diffs) n/a
Download CSV