Construct: ORF TRCN0000477167
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010082.1_s317c1
- Derived from:
- ccsbBroadEn_12180
- DNA Barcode:
- ACGTCCTACCCTAAGCCCTGGAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RIC8B (55188)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477167
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001351364.2 | 100% | 100% | |
| 2 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001330147.2 | 92.1% | 91.7% | (many diffs) |
| 3 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | XR_002957346.1 | 90.2% | (many diffs) | |
| 4 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001330146.2 | 89.4% | 88.9% | (many diffs) |
| 5 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001351361.2 | 88.3% | 87.6% | (many diffs) |
| 6 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001351363.2 | 87.7% | 85.9% | (many diffs) |
| 7 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001330145.2 | 86.9% | 86.4% | (many diffs) |
| 8 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001351362.2 | 86.6% | 84.6% | (many diffs) |
| 9 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_018157.4 | 85.2% | 83.4% | (many diffs) |
| 10 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001351366.2 | 84.7% | 84.6% | (many diffs) |
| 11 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NM_001351367.2 | 82.8% | 81.2% | (many diffs) |
| 12 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147135.2 | 28.8% | (many diffs) | |
| 13 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147137.2 | 28.2% | (many diffs) | |
| 14 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | XR_002957348.1 | 28% | (many diffs) | |
| 15 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147138.2 | 27.4% | (many diffs) | |
| 16 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147133.2 | 27.3% | (many diffs) | |
| 17 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147131.2 | 27.2% | (many diffs) | |
| 18 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | XR_001748786.2 | 26.3% | (many diffs) | |
| 19 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147139.2 | 26.3% | (many diffs) | |
| 20 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147136.2 | 26.1% | (many diffs) | |
| 21 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147132.2 | 25.4% | (many diffs) | |
| 22 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | NR_147134.2 | 24.7% | (many diffs) | |
| 23 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | XR_001748785.2 | 14.9% | (many diffs) | |
| 24 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | XR_002957347.1 | 14.9% | (many diffs) | |
| 25 | human | 55188 | RIC8B | RIC8 guanine nucleotide exc... | XR_002957345.1 | 13.2% | 0_1insATGCTTGCCAGT;1477_11092del | |
| 26 | mouse | 237422 | Ric8b | RIC8 guanine nucleotide exc... | XM_006513625.2 | 87% | 89.3% | (many diffs) |
| 27 | mouse | 237422 | Ric8b | RIC8 guanine nucleotide exc... | NM_183172.2 | 82.5% | 84.1% | (many diffs) |
| 28 | mouse | 237422 | Ric8b | RIC8 guanine nucleotide exc... | NM_001013441.2 | 79.8% | 81% | (many diffs) |
| 29 | mouse | 237422 | Ric8b | RIC8 guanine nucleotide exc... | XR_380393.2 | 60.6% | (many diffs) | |
| 30 | mouse | 237422 | Ric8b | RIC8 guanine nucleotide exc... | XR_380394.3 | 24.6% | (many diffs) | |
| 31 | mouse | 237422 | Ric8b | RIC8 guanine nucleotide exc... | XR_380392.2 | 24.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1557
- ORF length:
- 1488
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcttgccagt aaactctgtg aaggcatatt taaagtcctt ataaaggaca 121 tcccaacaac atgtcaagtg tcctgcctgg aagtactccg cattctctcc agagacaaaa 181 aggttttagt tcctgtgaca actaaggaaa atatgcagat actgctgcga ctagccaagc 241 taaatgagtt agatgattct ttggagaaag tatcagagtt cccagttatt gtggagtcat 301 taaaatgtct gtgtaatata gtgttcaaca gtcagatggc acagcagctc agcctggaac 361 ttaatcttgc tgcaaagctc tgtaacctcc tgagaaagtg caaggaccgg aaatttatca 421 atgacattaa gtgctttgac ttgcgcttgc tcttccttct gtcacttttg cacaccgaca 481 tcaggtcaca attgcgctat gagctccagg gactaccgct gctaacgcag atcttggaaa 541 gtgcctttag catcaagtgg accgatgagt atgaatcggc catagaccat aatggacctc 601 ctctctcacc tcaggagaca gactgtgcca ttgaggccct caaagctctc ttcaatgtga 661 cggtagacag ttggaaggtg cataaagaga gtgattctca tcagttccgt gtaatggcag 721 ctgtccttcg tcattgttta ctaatcgtag gtccaactga agacaaaaca gaagagctac 781 acagcaatgc agtcaacctt ttaagcaatg ttccagtctc ttgtttggat gttctcattt 841 gtccgttaac ccatgaagaa acagcccaag aggcaacgac tctagatgaa ctgcccagta 901 ataaaacagc tgagaaagaa acagttttga aaaacaatac catggtatac aatggtatga 961 atatggaggc cattcatgtt ttactgaatt ttatggagaa gagaatagac aagggaagca 1021 gctatagaga gggtctaact ccagttctca gcttattaac cgaatgttcc cgagcccatc 1081 gaaacatccg aaaatttctc aaagatcagg ttttaccacc gttgagggat gtgacaaatc 1141 gacctgaagt tggctcaact gtgagaaata agctggtgcg cctcatgaca catgttgacc 1201 ttggagtcaa gcaaattgct gctgaattcc tttttgtcct ttgcaaagag agagtggata 1261 gtctgctgaa atacactGGC TATGGGAATG CTGCAGGACT GTTGGCGGCC AGGGGCCTCT 1321 TGGCTGGAGG AAGAGGAGAT AATTGGTACT CAGAGGATGA GGACACAGAC ACTGAAGAAT 1381 ACAAAAATGC AAAACCAAAC ATTAATCTTA TCACTGGTCA TTTAGAGGAA CCAATGCCAA 1441 ACCCCATAGA TGAAATGACA GAAGAACAAA AAGAATATGA AGCCATGAAA CTTGTCAACA 1501 TGCTTGATAA ACTTTCCAGG AGAGCAGATG TGAAGGACCT GCACCAGGAT GGTGGTTTGC 1561 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1621 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1681 ATATATCTTG TGGAAAGGAC GAACGTCCTA CCCTAAGCCC TGGAGTACGC GTTAAGTCga 1741 caatcaacct ctggattaca aaatttgtga aagatt