Transcript: Human XR_002958705.1

PREDICTED: Homo sapiens family with sequence similarity 118 member A (FAM118A), transcript variant X20, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM118A (55007)
Length:
5369
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958705.1
NBCI Gene record:
FAM118A (55007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194380 CCATGATCTGATCCGGAAGAT pLKO.1 454 3UTR 100% 4.950 6.930 N Fam118a n/a
2 TRCN0000434843 GACCCTTCGTGATCAGATATT pLKO_005 3453 3UTR 100% 13.200 10.560 N FAM118A n/a
3 TRCN0000129352 CGAAACCGTCACATACACCAA pLKO.1 3921 3UTR 100% 2.640 2.112 N FAM118A n/a
4 TRCN0000415448 CTTTACTCCGTGCCGAATAAG pLKO_005 3487 3UTR 100% 13.200 9.240 N FAM118A n/a
5 TRCN0000129542 GCCCAAACGAAGAGGAATGTA pLKO.1 3872 3UTR 100% 5.625 3.938 N FAM118A n/a
6 TRCN0000130178 CGCACACAATCAGATACTGAT pLKO.1 3781 3UTR 100% 4.950 3.465 N FAM118A n/a
7 TRCN0000130418 GACACATTTCAGGTGGACTTT pLKO.1 4022 3UTR 100% 4.950 3.465 N FAM118A n/a
8 TRCN0000129205 CGAAGAGGAATGTATGGAGAA pLKO.1 3879 3UTR 100% 4.050 2.835 N FAM118A n/a
9 TRCN0000174961 GAAGACCATTTCTTTAAGCAT pLKO.1 3547 3UTR 100% 3.000 2.100 N Fam118a n/a
10 TRCN0000131030 CCAGAACTTATACCGCACCAA pLKO.1 3405 3UTR 100% 2.640 1.848 N FAM118A n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4471 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4471 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08451 pDONR223 100% 19.8% None (many diffs) n/a
2 ccsbBroad304_08451 pLX_304 0% 19.8% V5 (many diffs) n/a
3 TRCN0000480532 TAGCATGTCAGCTTCCGAGAGTTT pLX_317 39.1% 19.8% V5 (many diffs) n/a
Download CSV