Transcript: Human XR_002959554.1

PREDICTED: Homo sapiens methylcrotonoyl-CoA carboxylase 1 (MCCC1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCCC1 (56922)
Length:
1734
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959554.1
NBCI Gene record:
MCCC1 (56922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420604 GACGAAGTTTCCGTGCATTAT pLKO_005 1393 3UTR 100% 13.200 18.480 N MCCC1 n/a
2 TRCN0000435159 GCCATAGCTGTAACGTATAAC pLKO_005 1690 3UTR 100% 13.200 18.480 N MCCC1 n/a
3 TRCN0000078416 GCTATGCTGATCGAGAAGTTT pLKO.1 850 3UTR 100% 5.625 7.875 N MCCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08662 pDONR223 100% 63.1% None (many diffs) n/a
2 ccsbBroad304_08662 pLX_304 0% 63.1% V5 (many diffs) n/a
3 TRCN0000472827 CCGGAGTCCTGCCACCGGATAATG pLX_317 19.2% 63.1% V5 (many diffs) n/a
Download CSV