Transcript: Human XR_246426.3

PREDICTED: Homo sapiens coiled-coil domain containing 84 (CCDC84), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC84 (338657)
Length:
1258
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_246426.3
NBCI Gene record:
CCDC84 (338657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_246426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142088 CAACAAATTCTGGTGGGAGAA pLKO.1 384 3UTR 100% 4.050 5.670 N CCDC84 n/a
2 TRCN0000142380 GCGATTCAAGAAATCCATGGT pLKO.1 459 3UTR 100% 2.640 3.696 N CCDC84 n/a
3 TRCN0000139084 CCAACTTTGATCACAGCTCCA pLKO.1 963 3UTR 100% 2.160 3.024 N CCDC84 n/a
4 TRCN0000425866 AGGTGGTTCGGTCTGTCTTAG pLKO_005 569 3UTR 100% 10.800 7.560 N CCDC84 n/a
5 TRCN0000431206 GAACACCTGAGCCATGGAAAC pLKO_005 301 3UTR 100% 6.000 4.200 N CCDC84 n/a
6 TRCN0000142619 GCAGTCCAGACATCAATTCAA pLKO.1 1042 3UTR 100% 5.625 3.938 N CCDC84 n/a
7 TRCN0000427332 ACAAAGCTGAGGTCCAGATGA pLKO_005 404 3UTR 100% 4.950 3.465 N CCDC84 n/a
8 TRCN0000182073 CAAATTCTGGTGGGAGAACAA pLKO.1 387 3UTR 100% 4.950 3.465 N Ccdc84 n/a
9 TRCN0000414813 CAAGGAGATGGCAGCTCAGAT pLKO_005 522 3UTR 100% 4.950 3.465 N CCDC84 n/a
10 TRCN0000141451 CCATGGTGAAAGGTTTGGATT pLKO.1 473 3UTR 100% 4.950 3.465 N CCDC84 n/a
11 TRCN0000142042 GCAATGAAGAAGCAGTCACAT pLKO.1 1076 3UTR 100% 4.950 3.465 N CCDC84 n/a
12 TRCN0000122218 GCACAAGAAAGCAACCAACAA pLKO.1 369 3UTR 100% 4.950 3.465 N CCDC84 n/a
13 TRCN0000431285 ACCATCTCTGACATTCATTGG pLKO_005 769 3UTR 100% 4.050 2.835 N CCDC84 n/a
14 TRCN0000418199 AGGAGGATAAAGTGATCAAGG pLKO_005 506 3UTR 100% 4.050 2.835 N CCDC84 n/a
15 TRCN0000418397 GAGTTGGTAACATCCACTCAG pLKO_005 807 3UTR 100% 4.050 2.835 N CCDC84 n/a
16 TRCN0000141708 CCAAGAAATAGGACCATCCTA pLKO.1 877 3UTR 100% 3.000 2.100 N CCDC84 n/a
17 TRCN0000142381 GAATACATTGCTGGGAACCAA pLKO.1 860 3UTR 100% 3.000 2.100 N CCDC84 n/a
18 TRCN0000140219 GCTGGGAACCAAGAAATAGGA pLKO.1 869 3UTR 100% 3.000 2.100 N CCDC84 n/a
19 TRCN0000414147 AGTAGCTTCCAGCTTACAGCA pLKO_005 694 3UTR 100% 2.640 1.848 N CCDC84 n/a
20 TRCN0000139724 CCATCAGGATATACCAGGAGT pLKO.1 790 3UTR 100% 2.640 1.848 N CCDC84 n/a
21 TRCN0000140926 CCAACAAATTCTGGTGGGAGA pLKO.1 383 3UTR 100% 2.160 1.512 N CCDC84 n/a
22 TRCN0000436848 GGGCTCTTCAGCACCTAGAAG pLKO_005 618 3UTR 100% 1.650 1.155 N CCDC84 n/a
23 TRCN0000139860 CCCTGGATGATCCAAGATGAA pLKO.1 839 3UTR 100% 4.950 2.970 N CCDC84 n/a
24 TRCN0000421061 AGATGAAAGAGAAGTTTCTGG pLKO_005 419 3UTR 100% 2.640 1.584 N CCDC84 n/a
25 TRCN0000140566 GCAGCAATGAAGAAGCAGTCA pLKO.1 1073 3UTR 100% 2.640 1.584 N CCDC84 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_246426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05441 pDONR223 100% 79.1% None 1_78del;654_687del;1109_1258del n/a
2 ccsbBroad304_05441 pLX_304 0% 79.1% V5 1_78del;654_687del;1109_1258del n/a
3 TRCN0000467756 TACCTGTACCTGCCAGTTCTCTTC pLX_317 15.7% 79.1% V5 1_78del;654_687del;1109_1258del n/a
Download CSV